EMAIL THIS PAGE TO A FRIEND

ALPP

alkaline phosphatase, placental

40 Gene Product Result for
Synonyms: ALP PALP PLAP PLAP-1
UniProtKB ID: P05187, P05188, P06861, Q53S78, Q96DB7
Gene ID:
Human(250) Summary: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2 while the tissue non-specific form is located on chromosome 1. The product of this gene is a membrane bound glycosylated enzyme, also referred to as the heat stable form, that is expressed primarily in the placenta although it is closely related to the intestinal form of the enzyme as well as to the placental-like form. The coding sequence for this form of alkaline phosphatase is unique in that the 3' untranslated region contains multiple copies of an Alu family repeat. In addition, this gene is polymorphic and three common alleles (type 1, type 2 and type 3) for this form of alkaline phosphatase have been well characterized. [provided by RefSeq, Jul 2008]
Rat(100359675) alkaline phosphatase, placental
chicken(100859876) alkaline phosphatase, placental
dog(403736) alkaline phosphatase, placental
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
289868 Methylphosphonic acid 98% human pricing
305685 Propylphosphonic acid 95% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147291 MISSION® esiRNA esiRNA human ALPP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001632 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130591 predicted 2145
2 SASI_Hs01_00130592 predicted 468
3 SASI_Hs01_00130593 predicted 1991
4 SASI_Hs01_00130594 predicted 1926
5 SASI_Hs01_00130595 predicted 2124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001632
ALPP MISSION shRNA Bacterial Glycerol Stock
alkaline phosphatase, placental
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-1171s21c1
Sequence:GTACCGGCGCATCGACCATGGTCATCATCTCGAGATGATGACCATGGTCGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001632.3-2135s21c1
Sequence:GTACCGGCTTTGCTTCAGTCCTTGAATCCTCGAGGATTCAAGGACTGAAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-378s21c1
Sequence:GTACCGGGACAGCTGCCAGGATCCTAAACTCGAGTTTAGGATCCTGGCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-473s21c1
Sequence:GTACCGGAGACATACAATGTAGACAAACCTCGAGGTTTGTCTACATTGTATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-836s21c1
Sequence:GTACCGGGAGGCCGAAAGTACATGTTTCCTCGAGGAAACATGTACTTTCGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001632.3-1928s21c1
Sequence:GTACCGGGACTGAGCCCATGACACCAAACTCGAGTTTGGTGTCATGGGCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-1396s21c1
Sequence:GTACCGGACGGTCCTCCTATACGGAAACCTCGAGGTTTCCGTATAGGAGGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-215s1c1
Sequence:CCGGCGCCAAGAACCTCATCATCTTCTCGAGAAGATGATGAGGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-906s1c1
Sequence:CCGGGCCCATCTCATGGGTCTCTTTCTCGAGAAAGAGACCCATGAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-728s1c1
Sequence:CCGGCCGAAAGTACATGTTTCGCATCTCGAGATGCGAAACATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001632
ALPP MISSION shRNA shRNA Plasmid DNA
alkaline phosphatase, placental
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-1171s21c1
Sequence:GTACCGGCGCATCGACCATGGTCATCATCTCGAGATGATGACCATGGTCGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001632.3-2135s21c1
Sequence:GTACCGGCTTTGCTTCAGTCCTTGAATCCTCGAGGATTCAAGGACTGAAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-378s21c1
Sequence:GTACCGGGACAGCTGCCAGGATCCTAAACTCGAGTTTAGGATCCTGGCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-473s21c1
Sequence:GTACCGGAGACATACAATGTAGACAAACCTCGAGGTTTGTCTACATTGTATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-836s21c1
Sequence:GTACCGGGAGGCCGAAAGTACATGTTTCCTCGAGGAAACATGTACTTTCGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001632.3-1928s21c1
Sequence:GTACCGGGACTGAGCCCATGACACCAAACTCGAGTTTGGTGTCATGGGCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-1396s21c1
Sequence:GTACCGGACGGTCCTCCTATACGGAAACCTCGAGGTTTCCGTATAGGAGGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-215s1c1
Sequence:CCGGCGCCAAGAACCTCATCATCTTCTCGAGAAGATGATGAGGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-906s1c1
Sequence:CCGGGCCCATCTCATGGGTCTCTTTCTCGAGAAAGAGACCCATGAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-728s1c1
Sequence:CCGGCCGAAAGTACATGTTTCGCATCTCGAGATGCGAAACATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001632
ALPP MISSION shRNA Lentiviral Transduction Particles
alkaline phosphatase, placental
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-1171s21c1
Sequence:GTACCGGCGCATCGACCATGGTCATCATCTCGAGATGATGACCATGGTCGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001632.3-2135s21c1
Sequence:GTACCGGCTTTGCTTCAGTCCTTGAATCCTCGAGGATTCAAGGACTGAAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-378s21c1
Sequence:GTACCGGGACAGCTGCCAGGATCCTAAACTCGAGTTTAGGATCCTGGCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-473s21c1
Sequence:GTACCGGAGACATACAATGTAGACAAACCTCGAGGTTTGTCTACATTGTATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-836s21c1
Sequence:GTACCGGGAGGCCGAAAGTACATGTTTCCTCGAGGAAACATGTACTTTCGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001632.3-1928s21c1
Sequence:GTACCGGGACTGAGCCCATGACACCAAACTCGAGTTTGGTGTCATGGGCTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001632.3-1396s21c1
Sequence:GTACCGGACGGTCCTCCTATACGGAAACCTCGAGGTTTCCGTATAGGAGGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-215s1c1
Sequence:CCGGCGCCAAGAACCTCATCATCTTCTCGAGAAGATGATGAGGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-906s1c1
Sequence:CCGGGCCCATCTCATGGGTCTCTTTCTCGAGAAAGAGACCCATGAGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001632.2-728s1c1
Sequence:CCGGCCGAAAGTACATGTTTCGCATCTCGAGATGCGAAACATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks