EMAIL THIS PAGE TO A FRIEND

ALPPL2

alkaline phosphatase, placental-like 2

54 Gene Product Result for
Synonyms: ALPG ALPPL GCAP
UniProtKB ID: P10696, A8KAF2, Q16727, Q53S81, Q96CM1
Gene ID:
Human(251) Summary: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The product of this gene is a membrane bound glycosylated enzyme, localized to testis, thymus and certain germ cell tumors, that is closely related to both the placental and intestinal forms of alkaline phosphatase. [provided by RefSeq, Jul 2008]
Mouse(11650) alkaline phosphatase, placental-like 2
Rat(367308) alkaline phosphatase, placental-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031313 Rosetta Predictions human pricing
XM_001064732 Rosetta Predictions rat pricing
XM_346070 Rosetta Predictions rat pricing
NM_007433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172060 predicted 332
2 SASI_Hs01_00172061 predicted 1805
3 SASI_Hs01_00172059 predicted 1933
4 SASI_Hs02_00358759 predicted 1832
5 SASI_Hs01_00172062 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311577 predicted 877
2 SASI_Rn02_00311578 predicted 873
3 SASI_Rn02_00311579 predicted 975
4 SASI_Rn02_00311580 predicted 550
5 SASI_Rn02_00311581 predicted 1026
6 SASI_Rn02_00311582 predicted 886
7 SASI_Rn02_00311583 predicted 860
8 SASI_Rn02_00311584 predicted 1033
9 SASI_Rn02_00311585 predicted 968
10 SASI_Rn02_00311586 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399044 predicted 1140
2 SASI_Rn02_00399045 predicted 1048
3 SASI_Rn02_00399046 predicted 875
4 SASI_Rn02_00399047 predicted 872
5 SASI_Rn02_00399048 predicted 1016
6 SASI_Rn02_00399049 predicted 788
7 SASI_Rn02_00399050 predicted 978
8 SASI_Rn02_00399051 predicted 1029
9 SASI_Rn02_00399052 predicted 860
10 SASI_Rn02_00399053 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148885 predicted 590
2 SASI_Mm01_00148886 predicted 969
3 SASI_Mm01_00148887 predicted 1828
4 SASI_Mm01_00148888 predicted 715
5 SASI_Mm01_00148889 predicted 701
6 SASI_Mm01_00148890 predicted 345
7 SASI_Mm02_00311593 predicted 1014
8 SASI_Mm01_00148891 predicted 1362
9 SASI_Mm01_00148892 predicted 1368
10 SASI_Mm01_00148893 predicted 1743
11 SASI_Mm01_00148894 predicted 1167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031313
ALPPL2 MISSION shRNA Bacterial Glycerol Stock
alkaline phosphatase, placental-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-301s1c1
Sequence:CCGGGCCTGAGACCTTCCTGGCCATCTCGAGATGGCCAGGAAGGTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-718s1c1
Sequence:CCGGCCGAAAGTACATGTTTCCCATCTCGAGATGGGAAACATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-490s1c1
Sequence:CCGGCGAGGTCATCTCCGTGGTGAACTCGAGTTCACCACGGAGATGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1819s21c1
Sequence:CCGGGACACCACGCCCTTTGCTTTACTCGAGTAAAGCAAAGGGCGTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1984s21c1
Sequence:CCGGACATGAGGCACCCATACCTAGCTCGAGCTAGGTATGGGTGCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1943s21c1
Sequence:CCGGCCCATATCCTGAGGTGGATCACTCGAGTGATCCACCTCAGGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-2042s21c1
Sequence:CCGGACCTGAGGGACACAAGGACTTCTCGAGAAGTCCTTGTGTCCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031313.2-352s21c1
Sequence:CCGGAGACATACAGTGTAGACAAGCCTCGAGGCTTGTCTACACTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031313
ALPPL2 MISSION shRNA shRNA Plasmid DNA
alkaline phosphatase, placental-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-301s1c1
Sequence:CCGGGCCTGAGACCTTCCTGGCCATCTCGAGATGGCCAGGAAGGTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-718s1c1
Sequence:CCGGCCGAAAGTACATGTTTCCCATCTCGAGATGGGAAACATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-490s1c1
Sequence:CCGGCGAGGTCATCTCCGTGGTGAACTCGAGTTCACCACGGAGATGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1819s21c1
Sequence:CCGGGACACCACGCCCTTTGCTTTACTCGAGTAAAGCAAAGGGCGTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1984s21c1
Sequence:CCGGACATGAGGCACCCATACCTAGCTCGAGCTAGGTATGGGTGCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1943s21c1
Sequence:CCGGCCCATATCCTGAGGTGGATCACTCGAGTGATCCACCTCAGGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-2042s21c1
Sequence:CCGGACCTGAGGGACACAAGGACTTCTCGAGAAGTCCTTGTGTCCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031313.2-352s21c1
Sequence:CCGGAGACATACAGTGTAGACAAGCCTCGAGGCTTGTCTACACTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031313
ALPPL2 MISSION shRNA Lentiviral Transduction Particles
alkaline phosphatase, placental-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-301s1c1
Sequence:CCGGGCCTGAGACCTTCCTGGCCATCTCGAGATGGCCAGGAAGGTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-718s1c1
Sequence:CCGGCCGAAAGTACATGTTTCCCATCTCGAGATGGGAAACATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031313.1-490s1c1
Sequence:CCGGCGAGGTCATCTCCGTGGTGAACTCGAGTTCACCACGGAGATGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1819s21c1
Sequence:CCGGGACACCACGCCCTTTGCTTTACTCGAGTAAAGCAAAGGGCGTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1984s21c1
Sequence:CCGGACATGAGGCACCCATACCTAGCTCGAGCTAGGTATGGGTGCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-1943s21c1
Sequence:CCGGCCCATATCCTGAGGTGGATCACTCGAGTGATCCACCTCAGGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031313.2-2042s21c1
Sequence:CCGGACCTGAGGGACACAAGGACTTCTCGAGAAGTCCTTGTGTCCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031313.2-352s21c1
Sequence:CCGGAGACATACAGTGTAGACAAGCCTCGAGGCTTGTCTACACTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007433
ALPPL2 MISSION shRNA Bacterial Glycerol Stock
alkaline phosphatase, placental-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007433.2-1891s1c1
Sequence:CCGGGCCTCCTTCATCTGGTACTTTCTCGAGAAAGTACCAGATGAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1018s1c1
Sequence:CCGGCTTTGAGCCTAACGACATGAACTCGAGTTCATGTCGTTAGGCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1358s1c1
Sequence:CCGGGCTGAGGATGGCAAATCCTTTCTCGAGAAAGGATTTGCCATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1403s1c1
Sequence:CCGGCCTGGTTACAAGCTCCATAATCTCGAGATTATGGAGCTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-306s1c1
Sequence:CCGGCATCAGCTAAGAACCTCGTTACTCGAGTAACGAGGTTCTTAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007433
ALPPL2 MISSION shRNA shRNA Plasmid DNA
alkaline phosphatase, placental-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007433.2-1891s1c1
Sequence:CCGGGCCTCCTTCATCTGGTACTTTCTCGAGAAAGTACCAGATGAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1018s1c1
Sequence:CCGGCTTTGAGCCTAACGACATGAACTCGAGTTCATGTCGTTAGGCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1358s1c1
Sequence:CCGGGCTGAGGATGGCAAATCCTTTCTCGAGAAAGGATTTGCCATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1403s1c1
Sequence:CCGGCCTGGTTACAAGCTCCATAATCTCGAGATTATGGAGCTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-306s1c1
Sequence:CCGGCATCAGCTAAGAACCTCGTTACTCGAGTAACGAGGTTCTTAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007433
ALPPL2 MISSION shRNA Lentiviral Transduction Particles
alkaline phosphatase, placental-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007433.2-1891s1c1
Sequence:CCGGGCCTCCTTCATCTGGTACTTTCTCGAGAAAGTACCAGATGAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1018s1c1
Sequence:CCGGCTTTGAGCCTAACGACATGAACTCGAGTTCATGTCGTTAGGCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1358s1c1
Sequence:CCGGGCTGAGGATGGCAAATCCTTTCTCGAGAAAGGATTTGCCATCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-1403s1c1
Sequence:CCGGCCTGGTTACAAGCTCCATAATCTCGAGATTATGGAGCTTGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007433.2-306s1c1
Sequence:CCGGCATCAGCTAAGAACCTCGTTACTCGAGTAACGAGGTTCTTAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks