EMAIL THIS PAGE TO A FRIEND

ALS2

amyotrophic lateral sclerosis 2 (juvenile)

115 Gene Product Result for
Synonyms: ALS2CR6 ALSJ IAHSP PLSJ
Gene ID:
Human(57679) Summary: The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(74018) amyotrophic lateral sclerosis 2 (juvenile)
Rat(363235) amyotrophic lateral sclerosis 2 (juvenile)
chicken(424085) amyotrophic lateral sclerosis 2 (juvenile)
dog(478872) amyotrophic lateral sclerosis 2 (juvenile)
cow(535750) amyotrophic lateral sclerosis 2 (juvenile)
domestic cat(101094869) amyotrophic lateral sclerosis 2 (juvenile)
naked mole-rat(101698373) amyotrophic lateral sclerosis 2 (juvenile)
domestic guinea pig(100717157) amyotrophic lateral sclerosis 2 (juvenile)
sheep(101109592) amyotrophic lateral sclerosis 2 (juvenile)
Domestic Rabbit(100345931) amyotrophic lateral sclerosis 2 (juvenile)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020919 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000591 MISSION® esiRNA esiRNA targeting human ALS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020919 Rosetta Predictions human pricing
NM_001013413 Rosetta Predictions rat pricing
NM_028717 Rosetta Predictions mouse pricing
NM_146109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354282 predicted 3172
2 SASI_Hs02_00354283 predicted 4412
3 SASI_Hs01_00092909 predicted 3323
4 SASI_Hs01_00092912 predicted 4898
5 SASI_Hs01_00092913 predicted 4441
6 SASI_Hs02_00354284 predicted 4801
7 SASI_Hs02_00354285 predicted 2648
8 SASI_Hs01_00092914 predicted 242
9 SASI_Hs01_00092916 predicted 3639
10 SASI_Hs01_00092917 predicted 3918
11 SASI_Hs01_00092908 predicted 3763
12 SASI_Hs01_00092910 predicted 3736
13 SASI_Hs01_00092911 predicted 2550
14 SASI_Hs01_00092915 predicted 3921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201079 predicted 4359
2 SASI_Rn02_00201080 predicted 3885
3 SASI_Rn02_00201081 predicted 2698
4 SASI_Rn02_00201082 predicted 2442
5 SASI_Rn02_00201083 predicted 1339
6 SASI_Rn02_00201084 predicted 1842
7 SASI_Rn02_00201085 predicted 2428
8 SASI_Rn02_00201086 predicted 2078
9 SASI_Rn02_00201087 predicted 2069
10 SASI_Rn02_00201088 predicted 3434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334263 predicted 706
2 SASI_Mm02_00334264 predicted 912
3 SASI_Mm01_00193391 predicted 1361
4 SASI_Mm02_00334265 predicted 2237
5 SASI_Mm02_00334266 predicted 2421
6 SASI_Mm02_00334267 predicted 1447
7 SASI_Mm02_00334268 predicted 1122
8 SASI_Mm01_00193398 predicted 2461
9 SASI_Mm02_00334269 predicted 2341
10 SASI_Mm02_00334270 predicted 2100
11 SASI_Mm01_00193390 predicted 2145
12 SASI_Mm01_00193392 predicted 4623
13 SASI_Mm01_00193393 predicted 2540
14 SASI_Mm01_00193394 predicted 4754
15 SASI_Mm01_00193395 predicted 3973
16 SASI_Mm01_00193396 predicted 3690
17 SASI_Mm01_00193397 predicted 4582
18 SASI_Mm01_00193399 predicted 3835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341757 predicted 678
2 SASI_Mm02_00341758 predicted 890
3 SASI_Mm02_00341759 predicted 1343
4 SASI_Mm02_00341760 predicted 2219
5 SASI_Mm02_00341761 predicted 2394
6 SASI_Mm02_00341762 predicted 1419
7 SASI_Mm02_00341763 predicted 1103
8 SASI_Mm02_00341764 predicted 2441
9 SASI_Mm02_00341765 predicted 2322
10 SASI_Mm02_00341766 predicted 2076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020919
ALS2 MISSION shRNA Bacterial Glycerol Stock
amyotrophic lateral sclerosis 2 (juvenile)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020919.3-5457s21c1
Sequence:CCGGAGAATGAGCCTTACCAATAATCTCGAGATTATTGGTAAGGCTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020919.3-5358s21c1
Sequence:CCGGATCTACTACAGAGTGTTATAACTCGAGTTATAACACTCTGTAGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4082s21c1
Sequence:CCGGAGACTACATTGAAGGTTATTTCTCGAGAAATAACCTTCAATGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4603s21c1
Sequence:CCGGAGTCCTATCTTAAGCGAATTTCTCGAGAAATTCGCTTAAGATAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-1701s21c1
Sequence:CCGGAGCAGGGAAGAACAGGTTAAACTCGAGTTTAACCTGTTCTTCCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4559s21c1
Sequence:CCGGAGGAGCCAACCGCAGGTTATTCTCGAGAATAACCTGCGGTTGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4767s21c1
Sequence:CCGGGTAACGAGTTCTGGATTATTGCTCGAGCAATAATCCAGAACTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-3951s21c1
Sequence:CCGGGAGGGCAACTTTCACCTTAATCTCGAGATTAAGGTGAAAGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-4727s1c1
Sequence:CCGGCGACTAAATAAGCAGCCAGATCTCGAGATCTGGCTGCTTATTTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-3984s1c1
Sequence:CCGGCCTACTTCAAACCTAGTCTATCTCGAGATAGACTAGGTTTGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-3546s1c1
Sequence:CCGGGCTATGCTTCTGGTGAAGTATCTCGAGATACTTCACCAGAAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-2803s1c1
Sequence:CCGGGCAGGATTCCAGTTCTTGTTACTCGAGTAACAAGAACTGGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-1652s1c1
Sequence:CCGGCCTGGATTGTTGTCACAAGTTCTCGAGAACTTGTGACAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020919
ALS2 MISSION shRNA shRNA Plasmid DNA
amyotrophic lateral sclerosis 2 (juvenile)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020919.3-5457s21c1
Sequence:CCGGAGAATGAGCCTTACCAATAATCTCGAGATTATTGGTAAGGCTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020919.3-5358s21c1
Sequence:CCGGATCTACTACAGAGTGTTATAACTCGAGTTATAACACTCTGTAGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4082s21c1
Sequence:CCGGAGACTACATTGAAGGTTATTTCTCGAGAAATAACCTTCAATGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4603s21c1
Sequence:CCGGAGTCCTATCTTAAGCGAATTTCTCGAGAAATTCGCTTAAGATAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-1701s21c1
Sequence:CCGGAGCAGGGAAGAACAGGTTAAACTCGAGTTTAACCTGTTCTTCCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4559s21c1
Sequence:CCGGAGGAGCCAACCGCAGGTTATTCTCGAGAATAACCTGCGGTTGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4767s21c1
Sequence:CCGGGTAACGAGTTCTGGATTATTGCTCGAGCAATAATCCAGAACTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-3951s21c1
Sequence:CCGGGAGGGCAACTTTCACCTTAATCTCGAGATTAAGGTGAAAGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-4727s1c1
Sequence:CCGGCGACTAAATAAGCAGCCAGATCTCGAGATCTGGCTGCTTATTTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-3984s1c1
Sequence:CCGGCCTACTTCAAACCTAGTCTATCTCGAGATAGACTAGGTTTGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-3546s1c1
Sequence:CCGGGCTATGCTTCTGGTGAAGTATCTCGAGATACTTCACCAGAAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-2803s1c1
Sequence:CCGGGCAGGATTCCAGTTCTTGTTACTCGAGTAACAAGAACTGGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-1652s1c1
Sequence:CCGGCCTGGATTGTTGTCACAAGTTCTCGAGAACTTGTGACAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020919
ALS2 MISSION shRNA Lentiviral Transduction Particles
amyotrophic lateral sclerosis 2 (juvenile)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020919.3-5457s21c1
Sequence:CCGGAGAATGAGCCTTACCAATAATCTCGAGATTATTGGTAAGGCTCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020919.3-5358s21c1
Sequence:CCGGATCTACTACAGAGTGTTATAACTCGAGTTATAACACTCTGTAGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4082s21c1
Sequence:CCGGAGACTACATTGAAGGTTATTTCTCGAGAAATAACCTTCAATGTAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4603s21c1
Sequence:CCGGAGTCCTATCTTAAGCGAATTTCTCGAGAAATTCGCTTAAGATAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-1701s21c1
Sequence:CCGGAGCAGGGAAGAACAGGTTAAACTCGAGTTTAACCTGTTCTTCCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4559s21c1
Sequence:CCGGAGGAGCCAACCGCAGGTTATTCTCGAGAATAACCTGCGGTTGGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-4767s21c1
Sequence:CCGGGTAACGAGTTCTGGATTATTGCTCGAGCAATAATCCAGAACTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020919.3-3951s21c1
Sequence:CCGGGAGGGCAACTTTCACCTTAATCTCGAGATTAAGGTGAAAGTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-4727s1c1
Sequence:CCGGCGACTAAATAAGCAGCCAGATCTCGAGATCTGGCTGCTTATTTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-3984s1c1
Sequence:CCGGCCTACTTCAAACCTAGTCTATCTCGAGATAGACTAGGTTTGAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-3546s1c1
Sequence:CCGGGCTATGCTTCTGGTGAAGTATCTCGAGATACTTCACCAGAAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-2803s1c1
Sequence:CCGGGCAGGATTCCAGTTCTTGTTACTCGAGTAACAAGAACTGGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020919.2-1652s1c1
Sequence:CCGGCCTGGATTGTTGTCACAAGTTCTCGAGAACTTGTGACAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028717
VALIDATED
ALS2 MISSION shRNA Bacterial Glycerol Stock
amyotrophic lateral sclerosis 2 (juvenile)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-2526s21c1
Sequence:CCGGCCTGCCATTGATTTCCTAAATCTCGAGATTTAGGAAATCAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-3394s21c1
Sequence:CCGGCCCTGAACAAAGAAGACCATTCTCGAGAATGGTCTTCTTTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-4290s21c1
Sequence:CCGGGCGGTGTATAGAATGACATATCTCGAGATATGTCATTCTATACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-4793s21c1
Sequence:CCGGGCAGCAGATCAGCACAACATTCTCGAGAATGTTGTGCTGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-569s21c1
Sequence:CCGGCCCGTCATTAGCAGTTAGGATCTCGAGATCCTAACTGCTAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-2515s1c1
Sequence:CCGGCCTGCCATTGATTTCCTAAATCTCGAGATTTAGGAAATCAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-4782s1c1
Sequence:CCGGGCAGCAGATCAGCACAACATTCTCGAGAATGTTGTGCTGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-558s1c1
Sequence:CCGGCCCGTCATTAGCAGTTAGGATCTCGAGATCCTAACTGCTAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-4279s1c1
Sequence:CCGGGCGGTGTATAGAATGACATATCTCGAGATATGTCATTCTATACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-3383s1c1
Sequence:CCGGCCCTGAACAAAGAAGACCATTCTCGAGAATGGTCTTCTTTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028717
VALIDATED
ALS2 MISSION shRNA shRNA Plasmid DNA
amyotrophic lateral sclerosis 2 (juvenile)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-2526s21c1
Sequence:CCGGCCTGCCATTGATTTCCTAAATCTCGAGATTTAGGAAATCAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-3394s21c1
Sequence:CCGGCCCTGAACAAAGAAGACCATTCTCGAGAATGGTCTTCTTTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-4290s21c1
Sequence:CCGGGCGGTGTATAGAATGACATATCTCGAGATATGTCATTCTATACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-4793s21c1
Sequence:CCGGGCAGCAGATCAGCACAACATTCTCGAGAATGTTGTGCTGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-569s21c1
Sequence:CCGGCCCGTCATTAGCAGTTAGGATCTCGAGATCCTAACTGCTAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-2515s1c1
Sequence:CCGGCCTGCCATTGATTTCCTAAATCTCGAGATTTAGGAAATCAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-4782s1c1
Sequence:CCGGGCAGCAGATCAGCACAACATTCTCGAGAATGTTGTGCTGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-558s1c1
Sequence:CCGGCCCGTCATTAGCAGTTAGGATCTCGAGATCCTAACTGCTAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-4279s1c1
Sequence:CCGGGCGGTGTATAGAATGACATATCTCGAGATATGTCATTCTATACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-3383s1c1
Sequence:CCGGCCCTGAACAAAGAAGACCATTCTCGAGAATGGTCTTCTTTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028717
VALIDATED
ALS2 MISSION shRNA Lentiviral Transduction Particles
amyotrophic lateral sclerosis 2 (juvenile)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-2526s21c1
Sequence:CCGGCCTGCCATTGATTTCCTAAATCTCGAGATTTAGGAAATCAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-3394s21c1
Sequence:CCGGCCCTGAACAAAGAAGACCATTCTCGAGAATGGTCTTCTTTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-4290s21c1
Sequence:CCGGGCGGTGTATAGAATGACATATCTCGAGATATGTCATTCTATACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-4793s21c1
Sequence:CCGGGCAGCAGATCAGCACAACATTCTCGAGAATGTTGTGCTGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028717.4-569s21c1
Sequence:CCGGCCCGTCATTAGCAGTTAGGATCTCGAGATCCTAACTGCTAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-2515s1c1
Sequence:CCGGCCTGCCATTGATTTCCTAAATCTCGAGATTTAGGAAATCAATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-4782s1c1
Sequence:CCGGGCAGCAGATCAGCACAACATTCTCGAGAATGTTGTGCTGATCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-558s1c1
Sequence:CCGGCCCGTCATTAGCAGTTAGGATCTCGAGATCCTAACTGCTAATGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-4279s1c1
Sequence:CCGGGCGGTGTATAGAATGACATATCTCGAGATATGTCATTCTATACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028717.2-3383s1c1
Sequence:CCGGCCCTGAACAAAGAAGACCATTCTCGAGAATGGTCTTCTTTGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks