EMAIL THIS PAGE TO A FRIEND

ALS2CL

ALS2 C-terminal like

75 Gene Product Result for
Synonyms: RN49018
Gene ID:
Mouse(235633) ALS2 C-terminal like
Rat(316017) ALS2 C-terminal like
chicken(428401) ALS2 C-terminal like
cow(506969) ALS2 C-terminal like
Horse(100147424) ALS2 C-terminal like
domestic cat(101094487) ALS2 C-terminal like
dog(484786) ALS2 C-terminal like
sheep(101116432) ALS2 C-terminal like
Domestic Rabbit(100348991) ALS2 C-terminal like
domestic guinea pig(100720552) ALS2 C-terminal like
naked mole-rat(101718135) ALS2 C-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147129 Rosetta Predictions human pricing
NM_182775 Rosetta Predictions human pricing
XM_001076120 Rosetta Predictions rat pricing
XM_236654 Rosetta Predictions rat pricing
NM_146228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052148 predicted 2537
2 SASI_Hs01_00052149 predicted 2341
3 SASI_Hs01_00052151 predicted 2663
4 SASI_Hs01_00052152 predicted 2725
5 SASI_Hs02_00365472 predicted 2109
6 SASI_Hs02_00365473 predicted 2259
7 SASI_Hs02_00365474 predicted 2429
8 SASI_Hs02_00365475 predicted 2870
9 SASI_Hs02_00365476 predicted 2124
10 SASI_Hs02_00365477 predicted 2545
11 SASI_Hs01_00052150 predicted 3286
12 SASI_Hs01_00052153 predicted 3288
13 SASI_Hs01_00052154 predicted 2934
14 SASI_Hs01_00052155 predicted 3025
15 SASI_Hs01_00052156 predicted 2851
16 SASI_Hs01_00052157 predicted 3386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180065 predicted 943
2 SASI_Hs01_00180066 predicted 751
3 SASI_Hs01_00180067 predicted 1074
4 SASI_Hs02_00370939 predicted 1135
5 SASI_Hs01_00180069 predicted 520
6 SASI_Hs01_00180070 predicted 663
7 SASI_Hs01_00180071 predicted 837
8 SASI_Hs01_00180072 predicted 1276
9 SASI_Hs01_00180074 predicted 534
10 SASI_Hs02_00370940 predicted 954
11 SASI_Hs01_00180068 predicted 1260
12 SASI_Hs01_00180073 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352105 predicted 261
2 SASI_Rn02_00352106 predicted 436
3 SASI_Rn02_00352107 predicted 1351
4 SASI_Rn02_00352108 predicted 2761
5 SASI_Rn02_00352109 predicted 697
6 SASI_Rn02_00352110 predicted 1718
7 SASI_Rn02_00352111 predicted 2714
8 SASI_Rn02_00352112 predicted 2426
9 SASI_Rn02_00352113 predicted 2585
10 SASI_Rn02_00352114 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390279 predicted 259
2 SASI_Rn02_00390280 predicted 437
3 SASI_Rn02_00390281 predicted 1347
4 SASI_Rn02_00390282 predicted 2769
5 SASI_Rn02_00390283 predicted 697
6 SASI_Rn02_00390284 predicted 1718
7 SASI_Rn02_00390285 predicted 2718
8 SASI_Rn02_00390286 predicted 2433
9 SASI_Rn02_00390287 predicted 2586
10 SASI_Rn02_00390288 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028642 predicted 748
2 SASI_Mm01_00028643 predicted 510
3 SASI_Mm01_00028644 predicted 318
4 SASI_Mm01_00028645 predicted 2817
5 SASI_Mm01_00028647 predicted 2969
6 SASI_Mm01_00028648 predicted 974
7 SASI_Mm01_00028649 predicted 751
8 SASI_Mm01_00028650 predicted 2769
9 SASI_Mm02_00341927 predicted 1839
10 SASI_Mm01_00028651 predicted 1062
11 SASI_Mm01_00028646 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146228
ALS2CL MISSION shRNA Bacterial Glycerol Stock
ALS2 C-terminal like
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146228.3-4641s1c1
Sequence:CCGGGCCAAGAAATAAGAGAATCATCTCGAGATGATTCTCTTATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-1002s1c1
Sequence:CCGGCCTGAAGTTGGTGTGGGTAAACTCGAGTTTACCCACACCAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-445s1c1
Sequence:CCGGGCCGTGCTGTTACTGAGCAATCTCGAGATTGCTCAGTAACAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-1859s1c1
Sequence:CCGGCTTTCAGTAGTGGGACAGATACTCGAGTATCTGTCCCACTACTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-2646s1c1
Sequence:CCGGGCTGACAAGCAATCAGAGATACTCGAGTATCTCTGATTGCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146228.4-1209s21c1
Sequence:CCGGATGTCGCTGTGTGGCCTATACCTCGAGGTATAGGCCACACAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146228
ALS2CL MISSION shRNA shRNA Plasmid DNA
ALS2 C-terminal like
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146228.3-4641s1c1
Sequence:CCGGGCCAAGAAATAAGAGAATCATCTCGAGATGATTCTCTTATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-1002s1c1
Sequence:CCGGCCTGAAGTTGGTGTGGGTAAACTCGAGTTTACCCACACCAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-445s1c1
Sequence:CCGGGCCGTGCTGTTACTGAGCAATCTCGAGATTGCTCAGTAACAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-1859s1c1
Sequence:CCGGCTTTCAGTAGTGGGACAGATACTCGAGTATCTGTCCCACTACTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-2646s1c1
Sequence:CCGGGCTGACAAGCAATCAGAGATACTCGAGTATCTCTGATTGCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146228.4-1209s21c1
Sequence:CCGGATGTCGCTGTGTGGCCTATACCTCGAGGTATAGGCCACACAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146228
ALS2CL MISSION shRNA Lentiviral Transduction Particles
ALS2 C-terminal like
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146228.3-4641s1c1
Sequence:CCGGGCCAAGAAATAAGAGAATCATCTCGAGATGATTCTCTTATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-1002s1c1
Sequence:CCGGCCTGAAGTTGGTGTGGGTAAACTCGAGTTTACCCACACCAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-445s1c1
Sequence:CCGGGCCGTGCTGTTACTGAGCAATCTCGAGATTGCTCAGTAACAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-1859s1c1
Sequence:CCGGCTTTCAGTAGTGGGACAGATACTCGAGTATCTGTCCCACTACTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146228.3-2646s1c1
Sequence:CCGGGCTGACAAGCAATCAGAGATACTCGAGTATCTCTGATTGCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146228.4-1209s21c1
Sequence:CCGGATGTCGCTGTGTGGCCTATACCTCGAGGTATAGGCCACACAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147129
ALS2CL MISSION shRNA Bacterial Glycerol Stock
ALS2 C-terminal like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147129.2-3289s1c1
Sequence:CCGGCGCTGTAAAGGACCTTCCATTCTCGAGAATGGAAGGTCCTTTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-1960s1c1
Sequence:CCGGGCTGCGTAGGTCTCAGGATTACTCGAGTAATCCTGAGACCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-1269s1c1
Sequence:CCGGCTGAGGACAAGTTCGACTGTTCTCGAGAACAGTCGAACTTGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-353s1c1
Sequence:CCGGCAGGCCCACATAGAGTACATTCTCGAGAATGTACTCTATGTGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-932s1c1
Sequence:CCGGCCCGAAGAAGAGTTCTCCTTTCTCGAGAAAGGAGAACTCTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-2517s21c1
Sequence:CCGGTCACGCTGACGAGCAATCAGACTCGAGTCTGATTGCTCGTCAGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-1080s21c1
Sequence:CCGGACTGCCGCTGCGCAGAATATACTCGAGTATATTCTGCGCAGCGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-1495s21c1
Sequence:CCGGTGACAGAGGTGAGCGCTACATCTCGAGATGTAGCGCTCACCTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147129.2-3348s21c1
Sequence:CCGGTTTAGTCTGCTGGGCTGTATTCTCGAGAATACAGCCCAGCAGACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-854s21c1
Sequence:CCGGCACAATGTCCACACCTTTGATCTCGAGATCAAAGGTGTGGACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-2435s21c1
Sequence:CCGCATTGCCAACTTGAGCCTCTTTCTCGAGAAAGAGGCTCAAGTTGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-624s21c1
Sequence:CCGGTGAACGCAGTCACCCTCTTTGCTCGAGCAAAGAGGGTGACTGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147129.2-3136s21c1
Sequence:CCGGGCCACTAGCCCATCTTCAATGCTCGAGCATTGAAGATGGGCTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147129
ALS2CL MISSION shRNA shRNA Plasmid DNA
ALS2 C-terminal like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147129.2-3289s1c1
Sequence:CCGGCGCTGTAAAGGACCTTCCATTCTCGAGAATGGAAGGTCCTTTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-1960s1c1
Sequence:CCGGGCTGCGTAGGTCTCAGGATTACTCGAGTAATCCTGAGACCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-1269s1c1
Sequence:CCGGCTGAGGACAAGTTCGACTGTTCTCGAGAACAGTCGAACTTGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-353s1c1
Sequence:CCGGCAGGCCCACATAGAGTACATTCTCGAGAATGTACTCTATGTGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-932s1c1
Sequence:CCGGCCCGAAGAAGAGTTCTCCTTTCTCGAGAAAGGAGAACTCTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-2517s21c1
Sequence:CCGGTCACGCTGACGAGCAATCAGACTCGAGTCTGATTGCTCGTCAGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-1080s21c1
Sequence:CCGGACTGCCGCTGCGCAGAATATACTCGAGTATATTCTGCGCAGCGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-1495s21c1
Sequence:CCGGTGACAGAGGTGAGCGCTACATCTCGAGATGTAGCGCTCACCTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147129.2-3348s21c1
Sequence:CCGGTTTAGTCTGCTGGGCTGTATTCTCGAGAATACAGCCCAGCAGACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-854s21c1
Sequence:CCGGCACAATGTCCACACCTTTGATCTCGAGATCAAAGGTGTGGACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-2435s21c1
Sequence:CCGCATTGCCAACTTGAGCCTCTTTCTCGAGAAAGAGGCTCAAGTTGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-624s21c1
Sequence:CCGGTGAACGCAGTCACCCTCTTTGCTCGAGCAAAGAGGGTGACTGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147129.2-3136s21c1
Sequence:CCGGGCCACTAGCCCATCTTCAATGCTCGAGCATTGAAGATGGGCTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147129
ALS2CL MISSION shRNA Lentiviral Transduction Particles
ALS2 C-terminal like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147129.2-3289s1c1
Sequence:CCGGCGCTGTAAAGGACCTTCCATTCTCGAGAATGGAAGGTCCTTTACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-1960s1c1
Sequence:CCGGGCTGCGTAGGTCTCAGGATTACTCGAGTAATCCTGAGACCTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-1269s1c1
Sequence:CCGGCTGAGGACAAGTTCGACTGTTCTCGAGAACAGTCGAACTTGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-353s1c1
Sequence:CCGGCAGGCCCACATAGAGTACATTCTCGAGAATGTACTCTATGTGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147129.2-932s1c1
Sequence:CCGGCCCGAAGAAGAGTTCTCCTTTCTCGAGAAAGGAGAACTCTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-2517s21c1
Sequence:CCGGTCACGCTGACGAGCAATCAGACTCGAGTCTGATTGCTCGTCAGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-1080s21c1
Sequence:CCGGACTGCCGCTGCGCAGAATATACTCGAGTATATTCTGCGCAGCGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-1495s21c1
Sequence:CCGGTGACAGAGGTGAGCGCTACATCTCGAGATGTAGCGCTCACCTCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147129.2-3348s21c1
Sequence:CCGGTTTAGTCTGCTGGGCTGTATTCTCGAGAATACAGCCCAGCAGACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-854s21c1
Sequence:CCGGCACAATGTCCACACCTTTGATCTCGAGATCAAAGGTGTGGACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-2435s21c1
Sequence:CCGCATTGCCAACTTGAGCCTCTTTCTCGAGAAAGAGGCTCAAGTTGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147129.2-624s21c1
Sequence:CCGGTGAACGCAGTCACCCTCTTTGCTCGAGCAAAGAGGGTGACTGCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147129.2-3136s21c1
Sequence:CCGGGCCACTAGCCCATCTTCAATGCTCGAGCATTGAAGATGGGCTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks