EMAIL THIS PAGE TO A FRIEND

ALS2CR11

amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11

57 Gene Product Result for
UniProtKB ID: Q53TS8, C9IZH7, E9PGG4, Q8NCN6, Q96LN4
Gene ID:
Mouse(73463) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 (human)
Rat(501147) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
cow(616081) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152525 Rosetta Predictions human pricing
NM_001024363 Rosetta Predictions rat pricing
NM_175200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171099 predicted 1249
2 SASI_Hs01_00171100 predicted 1202
3 SASI_Hs01_00171101 predicted 1418
4 SASI_Hs01_00171102 predicted 604
5 SASI_Hs02_00366320 predicted 1627
6 SASI_Hs01_00171103 predicted 856
7 SASI_Hs01_00171104 predicted 1236
8 SASI_Hs01_00171105 predicted 506
9 SASI_Hs01_00171106 predicted 1539
10 SASI_Hs01_00171107 predicted 768
11 SASI_Hs01_00171108 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054754 predicted 1071
2 SASI_Rn02_00202594 predicted 1143
3 SASI_Rn01_00054755 predicted 550
4 SASI_Rn01_00054757 predicted 584
5 SASI_Rn02_00202595 predicted 1329
6 SASI_Rn01_00054758 predicted 1607
7 SASI_Rn01_00054759 predicted 1006
8 SASI_Rn01_00054760 predicted 916
9 SASI_Rn01_00054761 predicted 1501
10 SASI_Rn01_00054762 predicted 1612
11 SASI_Rn01_00054756 predicted 1627
12 SASI_Rn01_00054763 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149791 predicted 954
2 SASI_Mm01_00149792 predicted 1092
3 SASI_Mm01_00149794 predicted 1495
4 SASI_Mm01_00149795 predicted 1268
5 SASI_Mm01_00149796 predicted 1686
6 SASI_Mm02_00345865 predicted 1769
7 SASI_Mm01_00149797 predicted 1328
8 SASI_Mm01_00149798 predicted 607
9 SASI_Mm01_00149800 predicted 947
10 SASI_Mm02_00345866 predicted 1235
11 SASI_Mm01_00149793 predicted 1203
12 SASI_Mm01_00149799 predicted 999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152525
ALS2CR11 MISSION shRNA Bacterial Glycerol Stock
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152525.5-1769s21c1
Sequence:CCGGTATACTGCTCCGGAGGTTAACCTCGAGGTTAACCTCCGGAGCAGTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152525.5-1930s21c1
Sequence:CCGGGTTCGCTCATTTGTGATATTACTCGAGTAATATCACAAATGAGCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-129s1c1
Sequence:CCGGGCTATTGCAGAGGAATCCCTACTCGAGTAGGGATTCCTCTGCAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-157s1c1
Sequence:CCGGCCGGATATCATGCACATTAAACTCGAGTTTAATGTGCATGATATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-408s1c1
Sequence:CCGGGCCTAAGATCAGTTTACAACACTCGAGTGTTGTAAACTGATCTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-925s1c1
Sequence:CCGGCCAGACCTGAATGTTACTGTTCTCGAGAACAGTAACATTCAGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-1424s1c1
Sequence:CCGGCACCTTTAGGTGAACGTCAATCTCGAGATTGACGTTCACCTAAAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152525
ALS2CR11 MISSION shRNA shRNA Plasmid DNA
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152525.5-1769s21c1
Sequence:CCGGTATACTGCTCCGGAGGTTAACCTCGAGGTTAACCTCCGGAGCAGTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152525.5-1930s21c1
Sequence:CCGGGTTCGCTCATTTGTGATATTACTCGAGTAATATCACAAATGAGCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-129s1c1
Sequence:CCGGGCTATTGCAGAGGAATCCCTACTCGAGTAGGGATTCCTCTGCAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-157s1c1
Sequence:CCGGCCGGATATCATGCACATTAAACTCGAGTTTAATGTGCATGATATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-408s1c1
Sequence:CCGGGCCTAAGATCAGTTTACAACACTCGAGTGTTGTAAACTGATCTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-925s1c1
Sequence:CCGGCCAGACCTGAATGTTACTGTTCTCGAGAACAGTAACATTCAGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-1424s1c1
Sequence:CCGGCACCTTTAGGTGAACGTCAATCTCGAGATTGACGTTCACCTAAAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152525
ALS2CR11 MISSION shRNA Lentiviral Transduction Particles
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152525.5-1769s21c1
Sequence:CCGGTATACTGCTCCGGAGGTTAACCTCGAGGTTAACCTCCGGAGCAGTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152525.5-1930s21c1
Sequence:CCGGGTTCGCTCATTTGTGATATTACTCGAGTAATATCACAAATGAGCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-129s1c1
Sequence:CCGGGCTATTGCAGAGGAATCCCTACTCGAGTAGGGATTCCTCTGCAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-157s1c1
Sequence:CCGGCCGGATATCATGCACATTAAACTCGAGTTTAATGTGCATGATATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-408s1c1
Sequence:CCGGGCCTAAGATCAGTTTACAACACTCGAGTGTTGTAAACTGATCTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-925s1c1
Sequence:CCGGCCAGACCTGAATGTTACTGTTCTCGAGAACAGTAACATTCAGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152525.3-1424s1c1
Sequence:CCGGCACCTTTAGGTGAACGTCAATCTCGAGATTGACGTTCACCTAAAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175200
ALS2CR11 MISSION shRNA Bacterial Glycerol Stock
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-1299s1c1
Sequence:CCGGGAAAGGACAACATACGATATTCTCGAGAATATCGTATGTTGTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-834s1c1
Sequence:CCGGGTAATGCACTTGATGCATAAACTCGAGTTTATGCATCAAGTGCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-463s1c1
Sequence:CCGGCACCGAACTTGATACCATTTGCTCGAGCAAATGGTATCAAGTTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-463s21c1
Sequence:CCGGCACCGAACTTGATACCATTTGCTCGAGCAAATGGTATCAAGTTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-1299s21c1
Sequence:CCGGGAAAGGACAACATACGATATTCTCGAGAATATCGTATGTTGTCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-1152s21c1
Sequence:CCGGAGAATGAAAGAGGAGTATAAACTCGAGTTTATACTCCTCTTTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175200.3-1866s21c1
Sequence:CCGGAGTCTACTCAATACCAATAAACTCGAGTTTATTGGTATTGAGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-701s21c1
Sequence:CCGGTCAAGATGATGAGCGGAATTTCTCGAGAAATTCCGCTCATCATCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.2-506s1c1
Sequence:CCGGCGATTCACATAAAGAGCTGTACTCGAGTACAGCTCTTTATGTGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175200.2-1749s1c1
Sequence:CCGGGCTCCTGAGAGTTGAAATGAACTCGAGTTCATTTCAACTCTCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175200
ALS2CR11 MISSION shRNA shRNA Plasmid DNA
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-1299s1c1
Sequence:CCGGGAAAGGACAACATACGATATTCTCGAGAATATCGTATGTTGTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-834s1c1
Sequence:CCGGGTAATGCACTTGATGCATAAACTCGAGTTTATGCATCAAGTGCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-463s1c1
Sequence:CCGGCACCGAACTTGATACCATTTGCTCGAGCAAATGGTATCAAGTTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-463s21c1
Sequence:CCGGCACCGAACTTGATACCATTTGCTCGAGCAAATGGTATCAAGTTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-1299s21c1
Sequence:CCGGGAAAGGACAACATACGATATTCTCGAGAATATCGTATGTTGTCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-1152s21c1
Sequence:CCGGAGAATGAAAGAGGAGTATAAACTCGAGTTTATACTCCTCTTTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175200.3-1866s21c1
Sequence:CCGGAGTCTACTCAATACCAATAAACTCGAGTTTATTGGTATTGAGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-701s21c1
Sequence:CCGGTCAAGATGATGAGCGGAATTTCTCGAGAAATTCCGCTCATCATCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.2-506s1c1
Sequence:CCGGCGATTCACATAAAGAGCTGTACTCGAGTACAGCTCTTTATGTGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175200.2-1749s1c1
Sequence:CCGGGCTCCTGAGAGTTGAAATGAACTCGAGTTCATTTCAACTCTCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175200
ALS2CR11 MISSION shRNA Lentiviral Transduction Particles
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-1299s1c1
Sequence:CCGGGAAAGGACAACATACGATATTCTCGAGAATATCGTATGTTGTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-834s1c1
Sequence:CCGGGTAATGCACTTGATGCATAAACTCGAGTTTATGCATCAAGTGCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.3-463s1c1
Sequence:CCGGCACCGAACTTGATACCATTTGCTCGAGCAAATGGTATCAAGTTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-463s21c1
Sequence:CCGGCACCGAACTTGATACCATTTGCTCGAGCAAATGGTATCAAGTTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-1299s21c1
Sequence:CCGGGAAAGGACAACATACGATATTCTCGAGAATATCGTATGTTGTCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-1152s21c1
Sequence:CCGGAGAATGAAAGAGGAGTATAAACTCGAGTTTATACTCCTCTTTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175200.3-1866s21c1
Sequence:CCGGAGTCTACTCAATACCAATAAACTCGAGTTTATTGGTATTGAGTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175200.3-701s21c1
Sequence:CCGGTCAAGATGATGAGCGGAATTTCTCGAGAAATTCCGCTCATCATCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175200.2-506s1c1
Sequence:CCGGCGATTCACATAAAGAGCTGTACTCGAGTACAGCTCTTTATGTGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175200.2-1749s1c1
Sequence:CCGGGCTCCTGAGAGTTGAAATGAACTCGAGTTCATTTCAACTCTCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)