EMAIL THIS PAGE TO A FRIEND

ALS2CR12

amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12

72 Gene Product Result for
UniProtKB ID: Q96Q35, G5E9S3, Q53TT6, Q8N1B6
Gene ID:
Mouse(108812) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 (human)
Rat(316413) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
dog(488474) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
domestic cat(101086246) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
cow(784225) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
domestic guinea pig(100717435) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
naked mole-rat(101704364) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
sheep(101107577) amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127391 Rosetta Predictions human pricing
NM_139163 Rosetta Predictions human pricing
NM_001014101 Rosetta Predictions rat pricing
NM_175370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329384 predicted 587
2 SASI_Hs02_00329385 predicted 697
3 SASI_Hs02_00329386 predicted 642
4 SASI_Hs02_00329387 predicted 1632
5 SASI_Hs02_00329388 predicted 1640
6 SASI_Hs02_00329389 predicted 818
7 SASI_Hs02_00329390 predicted 549
8 SASI_Hs02_00329391 predicted 695
9 SASI_Hs02_00329392 predicted 899
10 SASI_Hs02_00329393 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364175 predicted 585
2 SASI_Hs01_00081069 predicted 699
3 SASI_Hs02_00364176 predicted 646
4 SASI_Hs02_00364177 predicted 1700
5 SASI_Hs02_00364178 predicted 1702
6 SASI_Hs02_00364179 predicted 818
7 SASI_Hs02_00364180 predicted 551
8 SASI_Hs02_00364181 predicted 694
9 SASI_Hs02_00364182 predicted 890
10 SASI_Hs02_00364183 predicted 579
11 SASI_Hs01_00081067 predicted 1249
12 SASI_Hs01_00081068 predicted 1086
13 SASI_Hs01_00081070 predicted 1122
14 SASI_Hs01_00081071 predicted 1370
15 SASI_Hs01_00081072 predicted 583
16 SASI_Hs01_00081073 predicted 1324
17 SASI_Hs01_00081074 predicted 1281
18 SASI_Hs01_00081075 predicted 1356
19 SASI_Hs01_00081076 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201539 predicted 1106
2 SASI_Rn02_00201540 predicted 601
3 SASI_Rn01_00112176 predicted 1224
4 SASI_Rn01_00112177 predicted 1519
5 SASI_Rn01_00112178 predicted 892
6 SASI_Rn01_00112179 predicted 1527
7 SASI_Rn01_00112180 predicted 614
8 SASI_Rn01_00112181 predicted 944
9 SASI_Rn01_00112182 predicted 1253
10 SASI_Rn01_00112183 predicted 1368
11 SASI_Rn01_00112175 predicted 792
12 SASI_Rn01_00112184 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057400 predicted 917
2 SASI_Mm01_00057402 predicted 774
3 SASI_Mm01_00057409 predicted 521
4 SASI_Mm02_00346179 predicted 515
5 SASI_Mm02_00346180 predicted 451
6 SASI_Mm02_00346181 predicted 421
7 SASI_Mm02_00346182 predicted 531
8 SASI_Mm02_00346183 predicted 457
9 SASI_Mm02_00346184 predicted 568
10 SASI_Mm02_00346185 predicted 648
11 SASI_Mm01_00057401 predicted 775
12 SASI_Mm01_00057403 predicted 1278
13 SASI_Mm01_00057404 predicted 825
14 SASI_Mm01_00057405 predicted 935
15 SASI_Mm01_00057406 predicted 769
16 SASI_Mm01_00057407 predicted 942
17 SASI_Mm01_00057408 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139163
ALS2CR12 MISSION shRNA Bacterial Glycerol Stock
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1541s1c1
Sequence:CCGGCATCTGAATTTCACAGCTTATCTCGAGATAAGCTGTGAAATTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139163.1-1239s1c1
Sequence:CCGGCGGAAGAGAACATTCATCTGACTCGAGTCAGATGAATGTTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1539s1c1
Sequence:CCGGCTCATCTGAATTTCACAGCTTCTCGAGAAGCTGTGAAATTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139163.1-251s1c1
Sequence:CCGGGCAAGGCAAGAAGAGACTAATCTCGAGATTAGTCTCTTCTTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-1109s21c1
Sequence:CCGGGTACGTATCAGGACAGTATTTCTCGAGAAATACTGTCCTGATACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-1503s21c1
Sequence:CCGGGAACACAAACCTCTACTATACCTCGAGGTATAGTAGAGGTTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-855s21c1
Sequence:CCGGGACAGCAATAATTGAACAAATCTCGAGATTTGTTCAATTATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1552s1c1
Sequence:CCGGCACAGCTTATCACGGACTCTTCTCGAGAAGAGTCCGTGATAAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139163
ALS2CR12 MISSION shRNA shRNA Plasmid DNA
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1541s1c1
Sequence:CCGGCATCTGAATTTCACAGCTTATCTCGAGATAAGCTGTGAAATTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139163.1-1239s1c1
Sequence:CCGGCGGAAGAGAACATTCATCTGACTCGAGTCAGATGAATGTTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1539s1c1
Sequence:CCGGCTCATCTGAATTTCACAGCTTCTCGAGAAGCTGTGAAATTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139163.1-251s1c1
Sequence:CCGGGCAAGGCAAGAAGAGACTAATCTCGAGATTAGTCTCTTCTTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-1109s21c1
Sequence:CCGGGTACGTATCAGGACAGTATTTCTCGAGAAATACTGTCCTGATACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-1503s21c1
Sequence:CCGGGAACACAAACCTCTACTATACCTCGAGGTATAGTAGAGGTTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-855s21c1
Sequence:CCGGGACAGCAATAATTGAACAAATCTCGAGATTTGTTCAATTATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1552s1c1
Sequence:CCGGCACAGCTTATCACGGACTCTTCTCGAGAAGAGTCCGTGATAAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139163
ALS2CR12 MISSION shRNA Lentiviral Transduction Particles
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202903    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1541s1c1
Sequence:CCGGCATCTGAATTTCACAGCTTATCTCGAGATAAGCTGTGAAATTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139163.1-1239s1c1
Sequence:CCGGCGGAAGAGAACATTCATCTGACTCGAGTCAGATGAATGTTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1539s1c1
Sequence:CCGGCTCATCTGAATTTCACAGCTTCTCGAGAAGCTGTGAAATTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139163.1-251s1c1
Sequence:CCGGGCAAGGCAAGAAGAGACTAATCTCGAGATTAGTCTCTTCTTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-1109s21c1
Sequence:CCGGGTACGTATCAGGACAGTATTTCTCGAGAAATACTGTCCTGATACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-1503s21c1
Sequence:CCGGGAACACAAACCTCTACTATACCTCGAGGTATAGTAGAGGTTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139163.2-855s21c1
Sequence:CCGGGACAGCAATAATTGAACAAATCTCGAGATTTGTTCAATTATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139163.1-1552s1c1
Sequence:CCGGCACAGCTTATCACGGACTCTTCTCGAGAAGAGTCCGTGATAAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175370
ALS2CR12 MISSION shRNA Bacterial Glycerol Stock
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175370.2-1317s1c1
Sequence:CCGGCGTTCCTGAACACAACAGCAACTCGAGTTGCTGTTGTGTTCAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175370.2-1344s1c1
Sequence:CCGGGCAAGCATCGTAGGTAACTAACTCGAGTTAGTTACCTACGATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-754s1c1
Sequence:CCGGCCATGTGTTTCAGGATAGCATCTCGAGATGCTATCCTGAAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-742s1c1
Sequence:CCGGGAAGAGTATGTTCCATGTGTTCTCGAGAACACATGGAACATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-494s1c1
Sequence:CCGGGCTGAGTTGATGGCAATAATACTCGAGTATTATTGCCATCAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175370.4-466s1c1
Sequence:CCGGGTCTTGAGCAAAGTCAAATTTCTCGAGAAATTTGACTTTGCTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175370
ALS2CR12 MISSION shRNA shRNA Plasmid DNA
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175370.2-1317s1c1
Sequence:CCGGCGTTCCTGAACACAACAGCAACTCGAGTTGCTGTTGTGTTCAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175370.2-1344s1c1
Sequence:CCGGGCAAGCATCGTAGGTAACTAACTCGAGTTAGTTACCTACGATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-754s1c1
Sequence:CCGGCCATGTGTTTCAGGATAGCATCTCGAGATGCTATCCTGAAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-742s1c1
Sequence:CCGGGAAGAGTATGTTCCATGTGTTCTCGAGAACACATGGAACATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-494s1c1
Sequence:CCGGGCTGAGTTGATGGCAATAATACTCGAGTATTATTGCCATCAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175370.4-466s1c1
Sequence:CCGGGTCTTGAGCAAAGTCAAATTTCTCGAGAAATTTGACTTTGCTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175370
ALS2CR12 MISSION shRNA Lentiviral Transduction Particles
amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175370.2-1317s1c1
Sequence:CCGGCGTTCCTGAACACAACAGCAACTCGAGTTGCTGTTGTGTTCAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175370.2-1344s1c1
Sequence:CCGGGCAAGCATCGTAGGTAACTAACTCGAGTTAGTTACCTACGATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-754s1c1
Sequence:CCGGCCATGTGTTTCAGGATAGCATCTCGAGATGCTATCCTGAAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-742s1c1
Sequence:CCGGGAAGAGTATGTTCCATGTGTTCTCGAGAACACATGGAACATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175370.2-494s1c1
Sequence:CCGGGCTGAGTTGATGGCAATAATACTCGAGTATTATTGCCATCAACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175370.4-466s1c1
Sequence:CCGGGTCTTGAGCAAAGTCAAATTTCTCGAGAAATTTGACTTTGCTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks