EMAIL THIS PAGE TO A FRIEND

ALX1

ALX homeobox 1

54 Gene Product Result for
Synonyms: CART1 FND3
UniProtKB ID: Q15699, Q546C8, Q96FH4
Gene ID:
Human(8092) Summary: The specific function of this gene has yet to be determined in humans; however, in rodents, it is necessary for survival of the forebrain mesenchyme and may also be involved in development of the cervix. Mutations in the mouse gene lead to neural tube defects such as acrania and meroanencephaly. [provided by RefSeq, Jul 2008]
Mouse(216285) ALX homeobox 1
Rat(25401) ALX homeobox 1
Zebrafish(565176) ALX homeobox 1
Horse(100061985) ALX homeobox 1
cow(539689) ALX homeobox 1
domestic cat(101095349) ALX homeobox 1
chicken(427871) ALX homeobox 1
dog(482587) ALX homeobox 1
sheep(101107946) ALX homeobox 1
naked mole-rat(101723577) ALX homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006982 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001841 MISSION® esiRNA esiRNA targeting human ALX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006982 Rosetta Predictions human pricing
NM_012921 Rosetta Predictions rat pricing
NM_172553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342716 predicted 273
2 SASI_Hs02_00342717 predicted 578
3 SASI_Hs01_00222863 predicted 225
4 SASI_Hs01_00222864 predicted 702
5 SASI_Hs02_00342718 predicted 373
6 SASI_Hs01_00222866 predicted 576
7 SASI_Hs01_00222867 predicted 663
8 SASI_Hs01_00222868 predicted 899
9 SASI_Hs01_00222869 predicted 973
10 SASI_Hs01_00222870 predicted 897
11 SASI_Hs01_00222861 predicted 1027
12 SASI_Hs01_00222862 predicted 532
13 SASI_Hs01_00222865 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012921 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062795 predicted 1068
2 SASI_Rn01_00062796 predicted 677
3 SASI_Rn01_00062797 predicted 860
4 SASI_Rn01_00062798 predicted 1124
5 SASI_Rn01_00062799 predicted 790
6 SASI_Rn01_00062800 predicted 1354
7 SASI_Rn01_00062801 predicted 1025
8 SASI_Rn02_00260462 predicted 1432
9 SASI_Rn01_00062803 predicted 1353
10 SASI_Rn02_00260463 predicted 895
11 SASI_Rn01_00062802 predicted 1041
12 SASI_Rn01_00062804 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022065 predicted 622
2 SASI_Mm01_00022066 predicted 824
3 SASI_Mm02_00344180 predicted 631
4 SASI_Mm01_00022067 predicted 1083
5 SASI_Mm01_00022068 predicted 786
6 SASI_Mm01_00022069 predicted 772
7 SASI_Mm01_00022070 predicted 1124
8 SASI_Mm01_00022073 predicted 571
9 SASI_Mm02_00344181 predicted 836
10 SASI_Mm02_00344182 predicted 1144
11 SASI_Mm01_00022064 predicted 396
12 SASI_Mm01_00022071 predicted 1079
13 SASI_Mm01_00022072 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172553
ALX1 MISSION shRNA Bacterial Glycerol Stock
ALX homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172553.4-1325s21c1
Sequence:CCGGGATCCCTGAAAGGACTAAATACTCGAGTATTTAGTCCTTTCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172553.4-1528s21c1
Sequence:CCGGTGTAAAGTGATACCTGATAAACTCGAGTTTATCAGGTATCACTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172553.4-1118s21c1
Sequence:CCGGAGGAGCACACCGCCAATATTTCTCGAGAAATATTGGCGGTGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-577s1c1
Sequence:CCGGCCGAACTACCTTTACCAGTTTCTCGAGAAACTGGTAAAGGTAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-396s1c1
Sequence:CCGGGCGTGAACTATGGAATCACCACTCGAGTGGTGATTCCATAGTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-1045s1c1
Sequence:CCGGCGGACACGCATTTGAAACAAACTCGAGTTTGTTTCAAATGCGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172553.1-1739s1c1
Sequence:CCGGGCTCTGTATTTGCATGGATATCTCGAGATATCCATGCAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-455s1c1
Sequence:CCGGGCAATGGATAACTGCAACAATCTCGAGATTGTTGCAGTTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172553
ALX1 MISSION shRNA shRNA Plasmid DNA
ALX homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172553.4-1325s21c1
Sequence:CCGGGATCCCTGAAAGGACTAAATACTCGAGTATTTAGTCCTTTCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172553.4-1528s21c1
Sequence:CCGGTGTAAAGTGATACCTGATAAACTCGAGTTTATCAGGTATCACTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172553.4-1118s21c1
Sequence:CCGGAGGAGCACACCGCCAATATTTCTCGAGAAATATTGGCGGTGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-577s1c1
Sequence:CCGGCCGAACTACCTTTACCAGTTTCTCGAGAAACTGGTAAAGGTAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-396s1c1
Sequence:CCGGGCGTGAACTATGGAATCACCACTCGAGTGGTGATTCCATAGTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-1045s1c1
Sequence:CCGGCGGACACGCATTTGAAACAAACTCGAGTTTGTTTCAAATGCGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172553.1-1739s1c1
Sequence:CCGGGCTCTGTATTTGCATGGATATCTCGAGATATCCATGCAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-455s1c1
Sequence:CCGGGCAATGGATAACTGCAACAATCTCGAGATTGTTGCAGTTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172553
ALX1 MISSION shRNA Lentiviral Transduction Particles
ALX homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172553.4-1325s21c1
Sequence:CCGGGATCCCTGAAAGGACTAAATACTCGAGTATTTAGTCCTTTCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172553.4-1528s21c1
Sequence:CCGGTGTAAAGTGATACCTGATAAACTCGAGTTTATCAGGTATCACTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172553.4-1118s21c1
Sequence:CCGGAGGAGCACACCGCCAATATTTCTCGAGAAATATTGGCGGTGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-577s1c1
Sequence:CCGGCCGAACTACCTTTACCAGTTTCTCGAGAAACTGGTAAAGGTAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-396s1c1
Sequence:CCGGGCGTGAACTATGGAATCACCACTCGAGTGGTGATTCCATAGTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-1045s1c1
Sequence:CCGGCGGACACGCATTTGAAACAAACTCGAGTTTGTTTCAAATGCGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172553.1-1739s1c1
Sequence:CCGGGCTCTGTATTTGCATGGATATCTCGAGATATCCATGCAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172553.1-455s1c1
Sequence:CCGGGCAATGGATAACTGCAACAATCTCGAGATTGTTGCAGTTATCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006982
ALX1 MISSION shRNA Bacterial Glycerol Stock
ALX homeobox 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-381s21c1
Sequence:CCGGATGTATCCAGCAGTAAGAAACCTCGAGGTTTCTTACTGCTGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-79s21c1
Sequence:CCGGAGGTCCTCTGGAGCACGTTATCTCGAGATAACGTGCTCCAGAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-742s21c1
Sequence:CCGGCTCCTGTATGACACCTTATTCCTCGAGGAATAAGGTGTCATACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006982.1-1229s1c1
Sequence:CCGGGAATTGCTAAAGGTCAAGATACTCGAGTATCTTGACCTTTAGCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-624s1c1
Sequence:CCGGCCGGATGTGTATGTCAGAGAACTCGAGTTCTCTGACATACACATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-769s1c1
Sequence:CCGGCCACCTATGATATATCAGTTTCTCGAGAAACTGATATATCATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-1112s1c1
Sequence:CCGGCGCCAATATTTCATGGGCCATCTCGAGATGGCCCATGAAATATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-379s1c1
Sequence:CCGGGCGTGAACTATGGGATCACTACTCGAGTAGTGATCCCATAGTTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006982
ALX1 MISSION shRNA shRNA Plasmid DNA
ALX homeobox 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-381s21c1
Sequence:CCGGATGTATCCAGCAGTAAGAAACCTCGAGGTTTCTTACTGCTGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-79s21c1
Sequence:CCGGAGGTCCTCTGGAGCACGTTATCTCGAGATAACGTGCTCCAGAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-742s21c1
Sequence:CCGGCTCCTGTATGACACCTTATTCCTCGAGGAATAAGGTGTCATACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006982.1-1229s1c1
Sequence:CCGGGAATTGCTAAAGGTCAAGATACTCGAGTATCTTGACCTTTAGCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-624s1c1
Sequence:CCGGCCGGATGTGTATGTCAGAGAACTCGAGTTCTCTGACATACACATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-769s1c1
Sequence:CCGGCCACCTATGATATATCAGTTTCTCGAGAAACTGATATATCATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-1112s1c1
Sequence:CCGGCGCCAATATTTCATGGGCCATCTCGAGATGGCCCATGAAATATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-379s1c1
Sequence:CCGGGCGTGAACTATGGGATCACTACTCGAGTAGTGATCCCATAGTTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006982
ALX1 MISSION shRNA Lentiviral Transduction Particles
ALX homeobox 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-381s21c1
Sequence:CCGGATGTATCCAGCAGTAAGAAACCTCGAGGTTTCTTACTGCTGGATACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-79s21c1
Sequence:CCGGAGGTCCTCTGGAGCACGTTATCTCGAGATAACGTGCTCCAGAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006982.2-742s21c1
Sequence:CCGGCTCCTGTATGACACCTTATTCCTCGAGGAATAAGGTGTCATACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006982.1-1229s1c1
Sequence:CCGGGAATTGCTAAAGGTCAAGATACTCGAGTATCTTGACCTTTAGCAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-624s1c1
Sequence:CCGGCCGGATGTGTATGTCAGAGAACTCGAGTTCTCTGACATACACATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-769s1c1
Sequence:CCGGCCACCTATGATATATCAGTTTCTCGAGAAACTGATATATCATAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-1112s1c1
Sequence:CCGGCGCCAATATTTCATGGGCCATCTCGAGATGGCCCATGAAATATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006982.1-379s1c1
Sequence:CCGGGCGTGAACTATGGGATCACTACTCGAGTAGTGATCCCATAGTTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks