EMAIL THIS PAGE TO A FRIEND

ALX3

ALX homeobox 3

69 Gene Product Result for
Synonyms: FND1
UniProtKB ID: O95076, O95075, Q5T8M4
Gene ID:
Human(257) Summary: This gene encodes a nuclear protein with a homeobox DNA-binding domain that functions as a transcriptional regulator involved in cell-type differentiation and development. Preferential methylation of this gene's promoter is associated with advanced-stage neuroblastoma tumors. [provided by RefSeq, Jul 2008]
Mouse(11694) aristaless-like homeobox 3
Rat(365900) ALX homeobox 3
naked mole-rat(101713137) ALX homeobox 3
sheep(101104710) ALX homeobox 3
chicken(100859561) ALX homeobox 3
cow(522085) ALX homeobox 3
domestic cat(101091717) ALX homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37852 Anti-ALX3 antibody produced in rabbit IgG fraction of antiserum human, guinea pig, rat, mouse
western blot pricing
SAB4501073 Anti-ALX3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
WH0000257M1 Monoclonal Anti-ALX3 antibody produced in mouse clone 1F1, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006492 Rosetta Predictions human pricing
NM_001007012 Rosetta Predictions rat pricing
XM_579167 Rosetta Predictions rat pricing
NM_007441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341686 predicted 1016
2 SASI_Hs02_00341687 predicted 1113
3 SASI_Hs01_00132226 predicted 547
4 SASI_Hs01_00132228 predicted 438
5 SASI_Hs01_00132232 predicted 1091
6 SASI_Hs01_00132233 predicted 1057
7 SASI_Hs02_00341688 predicted 542
8 SASI_Hs02_00341689 predicted 511
9 SASI_Hs02_00341690 predicted 1253
10 SASI_Hs02_00341691 predicted 1121
11 SASI_Hs01_00132224 predicted 1339
12 SASI_Hs01_00132225 predicted 1266
13 SASI_Hs01_00132227 predicted 1389
14 SASI_Hs01_00132229 predicted 946
15 SASI_Hs01_00132230 predicted 1370
16 SASI_Hs01_00132231 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087071 predicted 1506
2 SASI_Rn01_00087072 predicted 1141
3 SASI_Rn01_00087074 predicted 355
4 SASI_Rn01_00087075 predicted 571
5 SASI_Rn01_00087076 predicted 1254
6 SASI_Rn01_00087077 predicted 480
7 SASI_Rn01_00087079 predicted 1058
8 SASI_Rn01_00087080 predicted 750
9 SASI_Rn02_00198602 predicted 1520
10 SASI_Rn02_00198603 predicted 844
11 SASI_Rn01_00087073 predicted 1422
12 SASI_Rn01_00087078 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166917 predicted 874
2 SASI_Rn01_00166918 predicted 875
3 SASI_Rn01_00166919 predicted 539
4 SASI_Rn01_00166920 predicted 818
5 SASI_Rn01_00166921 predicted 666
6 SASI_Rn01_00166922 predicted 645
7 SASI_Rn01_00166923 predicted 461
8 SASI_Rn01_00166924 predicted 142
9 SASI_Rn01_00166925 predicted 239
10 SASI_Rn01_00166926 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196565 predicted 1340
2 SASI_Mm01_00196566 predicted 1117
3 SASI_Mm01_00196567 predicted 1186
4 SASI_Mm01_00196568 predicted 1621
5 SASI_Mm01_00196569 predicted 562
6 SASI_Mm01_00196570 predicted 821
7 SASI_Mm01_00196571 predicted 1196
8 SASI_Mm01_00196573 predicted 716
9 SASI_Mm01_00196574 predicted 703
10 SASI_Mm01_00196572 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006492
ALX3 MISSION shRNA Bacterial Glycerol Stock
ALX homeobox 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006492.1-1343s1c1
Sequence:CCGGCCAGACTTTGTCCAAGTCCATCTCGAGATGGACTTGGACAAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-277s1c1
Sequence:CCGGGCTGAGGAGAAGACCTCCAAACTCGAGTTTGGAGGTCTTCTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-883s1c1
Sequence:CCGGCCTGGCATCTACTCCATCCATCTCGAGATGGATGGAGTAGATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-940s1c1
Sequence:CCGGCCTTCCTCAGATGGTGACTATCTCGAGATAGTCACCATCTGAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006492.2-892s21c1
Sequence:CCGGCCCATGCATGTCTCCATATTCCTCGAGGAATATGGAGACATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006492.2-557s21c1
Sequence:CCGGCGCACGACCTTCAGCACATTCCTCGAGGAATGTGCTGAAGGTCGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006492
ALX3 MISSION shRNA shRNA Plasmid DNA
ALX homeobox 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006492.1-1343s1c1
Sequence:CCGGCCAGACTTTGTCCAAGTCCATCTCGAGATGGACTTGGACAAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-277s1c1
Sequence:CCGGGCTGAGGAGAAGACCTCCAAACTCGAGTTTGGAGGTCTTCTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-883s1c1
Sequence:CCGGCCTGGCATCTACTCCATCCATCTCGAGATGGATGGAGTAGATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-940s1c1
Sequence:CCGGCCTTCCTCAGATGGTGACTATCTCGAGATAGTCACCATCTGAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006492.2-892s21c1
Sequence:CCGGCCCATGCATGTCTCCATATTCCTCGAGGAATATGGAGACATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006492.2-557s21c1
Sequence:CCGGCGCACGACCTTCAGCACATTCCTCGAGGAATGTGCTGAAGGTCGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006492
ALX3 MISSION shRNA Lentiviral Transduction Particles
ALX homeobox 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006492.1-1343s1c1
Sequence:CCGGCCAGACTTTGTCCAAGTCCATCTCGAGATGGACTTGGACAAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-277s1c1
Sequence:CCGGGCTGAGGAGAAGACCTCCAAACTCGAGTTTGGAGGTCTTCTCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-883s1c1
Sequence:CCGGCCTGGCATCTACTCCATCCATCTCGAGATGGATGGAGTAGATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006492.1-940s1c1
Sequence:CCGGCCTTCCTCAGATGGTGACTATCTCGAGATAGTCACCATCTGAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006492.2-892s21c1
Sequence:CCGGCCCATGCATGTCTCCATATTCCTCGAGGAATATGGAGACATGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006492.2-557s21c1
Sequence:CCGGCGCACGACCTTCAGCACATTCCTCGAGGAATGTGCTGAAGGTCGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007441
ALX3 MISSION shRNA Bacterial Glycerol Stock
ALX homeobox 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007441.1-1716s1c1
Sequence:CCGGGCTAGTCTACAGAGATACTATCTCGAGATAGTATCTCTGTAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-1031s1c1
Sequence:CCGGCCTGGCATCTATTCCATCCATCTCGAGATGGATGGAATAGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-824s1c1
Sequence:CCGGACAGCCTATGACATCTCCGTACTCGAGTACGGAGATGTCATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-778s1c1
Sequence:CCGGGCGTGAGCGTTATGGGAAGATCTCGAGATCTTCCCATAACGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-1120s1c1
Sequence:CCGGCCTCGTTTCACTCAGGATGAACTCGAGTTCATCCTGAGTGAAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007441.2-1642s21c1
Sequence:CCGGACGGTGAAGGTCAGCTCAATACTCGAGTATTGAGCTGACCTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007441.2-1406s21c1
Sequence:CCGGAGGTAGGACTCCTCCTTATAACTCGAGTTATAAGGAGGAGTCCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007441
ALX3 MISSION shRNA shRNA Plasmid DNA
ALX homeobox 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007441.1-1716s1c1
Sequence:CCGGGCTAGTCTACAGAGATACTATCTCGAGATAGTATCTCTGTAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-1031s1c1
Sequence:CCGGCCTGGCATCTATTCCATCCATCTCGAGATGGATGGAATAGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-824s1c1
Sequence:CCGGACAGCCTATGACATCTCCGTACTCGAGTACGGAGATGTCATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-778s1c1
Sequence:CCGGGCGTGAGCGTTATGGGAAGATCTCGAGATCTTCCCATAACGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-1120s1c1
Sequence:CCGGCCTCGTTTCACTCAGGATGAACTCGAGTTCATCCTGAGTGAAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007441.2-1642s21c1
Sequence:CCGGACGGTGAAGGTCAGCTCAATACTCGAGTATTGAGCTGACCTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007441.2-1406s21c1
Sequence:CCGGAGGTAGGACTCCTCCTTATAACTCGAGTTATAAGGAGGAGTCCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007441
ALX3 MISSION shRNA Lentiviral Transduction Particles
ALX homeobox 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007441.1-1716s1c1
Sequence:CCGGGCTAGTCTACAGAGATACTATCTCGAGATAGTATCTCTGTAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-1031s1c1
Sequence:CCGGCCTGGCATCTATTCCATCCATCTCGAGATGGATGGAATAGATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-824s1c1
Sequence:CCGGACAGCCTATGACATCTCCGTACTCGAGTACGGAGATGTCATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-778s1c1
Sequence:CCGGGCGTGAGCGTTATGGGAAGATCTCGAGATCTTCCCATAACGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007441.1-1120s1c1
Sequence:CCGGCCTCGTTTCACTCAGGATGAACTCGAGTTCATCCTGAGTGAAACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007441.2-1642s21c1
Sequence:CCGGACGGTGAAGGTCAGCTCAATACTCGAGTATTGAGCTGACCTTCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007441.2-1406s21c1
Sequence:CCGGAGGTAGGACTCCTCCTTATAACTCGAGTTATAAGGAGGAGTCCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks