EMAIL THIS PAGE TO A FRIEND

ALYREF

Aly/REF export factor

55 Gene Product Result for
Synonyms: ALY ALY/REF BEF REF THOC4
UniProtKB ID: Q86V81, O43672
Gene ID:
Human(10189) Summary: The protein encoded by this gene is a heat stable, nuclear protein and functions as a molecular chaperone. It is thought to regulate dimerization, DNA binding, and transcriptional activity of basic region-leucine zipper (bZIP) proteins. [provided by RefSeq, Jul 2008]
Mouse(21681) Aly/REF export factor
Rat(690585) Aly/REF export factor
Zebrafish(560127) Aly/REF export factor
cow(537706) THO complex 4
domestic cat(101100167) Aly/REF export factor
chicken(769169) Aly/REF export factor
naked mole-rat(101714006) Aly/REF export factor
domestic guinea pig(100713536) Aly/REF export factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A9979 Anti-Aly antibody, Mouse monoclonal clone 11G5, purified from hybridoma cell culture human, Xenopus
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
HPA019799 Anti-ALYREF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702076 Anti-ALYREF antibody produced in rabbit human, mouse
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
HPA061282 Anti-ALYREF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4301033 Anti-ALYREF antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry pricing
AV43055 Anti-THOC4 antibody produced in rabbit IgG fraction of antiserum zebrafish, bovine, rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111261 MISSION® esiRNA esiRNA human THOC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005782 Rosetta Predictions human pricing
NM_001109602 Rosetta Predictions rat pricing
NM_011568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067385 predicted 676
2 SASI_Hs01_00067386 predicted 681
3 SASI_Hs01_00067387 predicted 473
4 SASI_Hs01_00067390 predicted 447
5 SASI_Hs01_00067393 predicted 685
6 SASI_Hs02_00340272 predicted 465
7 SASI_Hs02_00340273 predicted 677
8 SASI_Hs02_00340274 predicted 474
9 SASI_Hs02_00340275 predicted 451
10 SASI_Hs02_00340276 predicted 556
11 SASI_Hs01_00067388 predicted 709
12 SASI_Hs01_00067389 predicted 592
13 SASI_Hs01_00067391 predicted 595
14 SASI_Hs01_00067392 predicted 713
15 SASI_Hs01_00067394 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249987 predicted 663
2 SASI_Rn02_00249988 predicted 704
3 SASI_Rn02_00249989 predicted 381
4 SASI_Rn02_00249990 predicted 250
5 SASI_Rn02_00249991 predicted 468
6 SASI_Rn02_00249992 predicted 679
7 SASI_Rn02_00249993 predicted 394
8 SASI_Rn02_00249994 predicted 277
9 SASI_Rn02_00249995 predicted 406
10 SASI_Rn02_00249996 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194006 predicted 259
2 SASI_Mm01_00194007 predicted 398
3 SASI_Mm01_00194008 predicted 272
4 SASI_Mm01_00194009 predicted 569
5 SASI_Mm01_00194010 predicted 575
6 SASI_Mm02_00320951 predicted 557
7 SASI_Mm02_00320952 predicted 562
8 SASI_Mm02_00320953 predicted 505
9 SASI_Mm01_00194012 predicted 822
10 SASI_Mm01_00194013 predicted 793
11 SASI_Mm01_00194011 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005782
VALIDATED
ALYREF MISSION shRNA Bacterial Glycerol Stock
Aly/REF export factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005782.x-330s1c1
Sequence:CCGGCGTGGAGACAGGTGGGAAACTCTCGAGAGTTTCCCACCTGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-397s1c1
Sequence:CCGGGAACTCTTTGCTGAATTTGGACTCGAGTCCAAATTCAGCAAAGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-379s1c1
Sequence:CCGGTCAGACGCCGATATTCAGGAACTCGAGTTCCTGAATATCGGCGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-402s1c1
Sequence:CCGGCTTTGCTGAATTTGGAACGCTCTCGAGAGCGTTCCAAATTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-440s1c1
Sequence:CCGGACTATGATCGCTCTGGTCGCACTCGAGTGCGACCAGAGCGATCATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-769s21c1
Sequence:CCGGGACGCCTATAATGCGAGAATGCTCGAGCATTCTCGCATTATAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-373s21c1
Sequence:CCGGGGAGTCTCAGACGCCGATATTCTCGAGAATATCGGCGTCTGAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-397s21c1
Sequence:CCGGGAACTCTTTGCTGAATTTGGACTCGAGTCCAAATTCAGCAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-330s21c1
Sequence:CCGGCGTGGAGACAGGTGGGAAACTCTCGAGAGTTTCCCACCTGTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005782
VALIDATED
ALYREF MISSION shRNA shRNA Plasmid DNA
Aly/REF export factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005782.x-330s1c1
Sequence:CCGGCGTGGAGACAGGTGGGAAACTCTCGAGAGTTTCCCACCTGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-397s1c1
Sequence:CCGGGAACTCTTTGCTGAATTTGGACTCGAGTCCAAATTCAGCAAAGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-379s1c1
Sequence:CCGGTCAGACGCCGATATTCAGGAACTCGAGTTCCTGAATATCGGCGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-402s1c1
Sequence:CCGGCTTTGCTGAATTTGGAACGCTCTCGAGAGCGTTCCAAATTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-440s1c1
Sequence:CCGGACTATGATCGCTCTGGTCGCACTCGAGTGCGACCAGAGCGATCATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-769s21c1
Sequence:CCGGGACGCCTATAATGCGAGAATGCTCGAGCATTCTCGCATTATAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-373s21c1
Sequence:CCGGGGAGTCTCAGACGCCGATATTCTCGAGAATATCGGCGTCTGAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-397s21c1
Sequence:CCGGGAACTCTTTGCTGAATTTGGACTCGAGTCCAAATTCAGCAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-330s21c1
Sequence:CCGGCGTGGAGACAGGTGGGAAACTCTCGAGAGTTTCCCACCTGTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005782
VALIDATED
ALYREF MISSION shRNA Lentiviral Transduction Particles
Aly/REF export factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005782.x-330s1c1
Sequence:CCGGCGTGGAGACAGGTGGGAAACTCTCGAGAGTTTCCCACCTGTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-397s1c1
Sequence:CCGGGAACTCTTTGCTGAATTTGGACTCGAGTCCAAATTCAGCAAAGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-379s1c1
Sequence:CCGGTCAGACGCCGATATTCAGGAACTCGAGTTCCTGAATATCGGCGTCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-402s1c1
Sequence:CCGGCTTTGCTGAATTTGGAACGCTCTCGAGAGCGTTCCAAATTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005782.x-440s1c1
Sequence:CCGGACTATGATCGCTCTGGTCGCACTCGAGTGCGACCAGAGCGATCATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-769s21c1
Sequence:CCGGGACGCCTATAATGCGAGAATGCTCGAGCATTCTCGCATTATAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-373s21c1
Sequence:CCGGGGAGTCTCAGACGCCGATATTCTCGAGAATATCGGCGTCTGAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-397s21c1
Sequence:CCGGGAACTCTTTGCTGAATTTGGACTCGAGTCCAAATTCAGCAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005782.2-330s21c1
Sequence:CCGGCGTGGAGACAGGTGGGAAACTCTCGAGAGTTTCCCACCTGTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011568
VALIDATED
ALYREF MISSION shRNA Bacterial Glycerol Stock
Aly/REF export factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011568.1-865s1c1
Sequence:CCGGGCAACTGAACTGTGCAGACAACTCGAGTTGTCTGCACAGTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011568.1-558s1c1
Sequence:CCGGCCAGCTTGTCACATCACAGATCTCGAGATCTGTGATGTGACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011568.1-603s1c1
Sequence:CCGGGAGCATAAACAGAGGCGGCATCTCGAGATGCCGCCTCTGTTTATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011568.1-382s1c1
Sequence:CCGGGCTGATATTCAGGAACTCTTTCTCGAGAAAGAGTTCCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-865s21c1
Sequence:CCGGGCAACTGAACTGTGCAGACAACTCGAGTTGTCTGCACAGTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-263s21c1
Sequence:CCGGCGAAACAACTTCCCGACAAATCTCGAGATTTGTCGGGAAGTTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-382s21c1
Sequence:CCGGGCTGATATTCAGGAACTCTTTCTCGAGAAAGAGTTCCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011568.1-792s21c1
Sequence:CCGGCTAAACAACTGAGCAAATCCACTCGAGTGGATTTGCTCAGTTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-558s21c1
Sequence:CCGGCCAGCTTGTCACATCACAGATCTCGAGATCTGTGATGTGACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011568
VALIDATED
ALYREF MISSION shRNA shRNA Plasmid DNA
Aly/REF export factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011568.1-865s1c1
Sequence:CCGGGCAACTGAACTGTGCAGACAACTCGAGTTGTCTGCACAGTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011568.1-558s1c1
Sequence:CCGGCCAGCTTGTCACATCACAGATCTCGAGATCTGTGATGTGACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011568.1-603s1c1
Sequence:CCGGGAGCATAAACAGAGGCGGCATCTCGAGATGCCGCCTCTGTTTATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011568.1-382s1c1
Sequence:CCGGGCTGATATTCAGGAACTCTTTCTCGAGAAAGAGTTCCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-865s21c1
Sequence:CCGGGCAACTGAACTGTGCAGACAACTCGAGTTGTCTGCACAGTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-263s21c1
Sequence:CCGGCGAAACAACTTCCCGACAAATCTCGAGATTTGTCGGGAAGTTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-382s21c1
Sequence:CCGGGCTGATATTCAGGAACTCTTTCTCGAGAAAGAGTTCCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011568.1-792s21c1
Sequence:CCGGCTAAACAACTGAGCAAATCCACTCGAGTGGATTTGCTCAGTTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-558s21c1
Sequence:CCGGCCAGCTTGTCACATCACAGATCTCGAGATCTGTGATGTGACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011568
VALIDATED
ALYREF MISSION shRNA Lentiviral Transduction Particles
Aly/REF export factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011568.1-865s1c1
Sequence:CCGGGCAACTGAACTGTGCAGACAACTCGAGTTGTCTGCACAGTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011568.1-558s1c1
Sequence:CCGGCCAGCTTGTCACATCACAGATCTCGAGATCTGTGATGTGACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011568.1-603s1c1
Sequence:CCGGGAGCATAAACAGAGGCGGCATCTCGAGATGCCGCCTCTGTTTATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011568.1-382s1c1
Sequence:CCGGGCTGATATTCAGGAACTCTTTCTCGAGAAAGAGTTCCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-865s21c1
Sequence:CCGGGCAACTGAACTGTGCAGACAACTCGAGTTGTCTGCACAGTTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-263s21c1
Sequence:CCGGCGAAACAACTTCCCGACAAATCTCGAGATTTGTCGGGAAGTTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-382s21c1
Sequence:CCGGGCTGATATTCAGGAACTCTTTCTCGAGAAAGAGTTCCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011568.1-792s21c1
Sequence:CCGGCTAAACAACTGAGCAAATCCACTCGAGTGGATTTGCTCAGTTGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011568.1-558s21c1
Sequence:CCGGCCAGCTTGTCACATCACAGATCTCGAGATCTGTGATGTGACAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks