EMAIL THIS PAGE TO A FRIEND

AMBN

ameloblastin (enamel matrix protein)

98 Gene Product Result for
UniProtKB ID: Q9NP70, Q3B862, Q9H2X1, Q9H4L1
Gene ID:
Human(258) Summary: This gene encodes the nonamelogenin enamel matrix protein ameloblastin. The encoded protein may be important in enamel matrix formation and mineralization. This gene is located in the calcium-binding phosphoprotein gene cluster on chromosome 4. Mutations in this gene may be associated with dentinogenesis imperfect and autosomal dominant amylogenesis imperfect. [provided by RefSeq, Aug 2011]
Mouse(11698) ameloblastin
Rat(25376) ameloblastin
dog(482185) ameloblastin (enamel matrix protein)
cow(280995) ameloblastin (enamel matrix protein)
domestic cat(101096807) ameloblastin (enamel matrix protein)
sheep(101121095) ameloblastin (enamel matrix protein)
naked mole-rat(101717090) ameloblastin (enamel matrix protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405451 Anti-AMBN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107636 Anti-AMBN antibody produced in rabbit affinity isolated antibody guinea pig, horse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016519 Rosetta Predictions human pricing
NM_012900 Rosetta Predictions rat pricing
NM_009664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140367 predicted 219
2 SASI_Hs01_00140368 predicted 1426
3 SASI_Hs01_00140369 predicted 360
4 SASI_Hs02_00349610 predicted 720
5 SASI_Hs01_00140370 predicted 352
6 SASI_Hs01_00140372 predicted 1378
7 SASI_Hs02_00349611 predicted 511
8 SASI_Hs01_00140373 predicted 1247
9 SASI_Hs02_00349612 predicted 486
10 SASI_Hs01_00140376 predicted 954
11 SASI_Hs01_00140371 predicted 1425
12 SASI_Hs01_00140374 predicted 1308
13 SASI_Hs01_00140375 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034931 predicted 1331
2 SASI_Rn01_00034932 predicted 1368
3 SASI_Rn01_00034933 predicted 396
4 SASI_Rn01_00034934 predicted 669
5 SASI_Rn01_00034935 predicted 308
6 SASI_Rn01_00034937 predicted 871
7 SASI_Rn02_00260427 predicted 1367
8 SASI_Rn01_00034938 predicted 760
9 SASI_Rn01_00034940 predicted 232
10 SASI_Rn02_00260428 predicted 222
11 SASI_Rn01_00034936 predicted 281
12 SASI_Rn01_00034939 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150424 predicted 1400
2 SASI_Mm01_00150425 predicted 1376
3 SASI_Mm02_00316682 predicted 251
4 SASI_Mm01_00150426 predicted 662
5 SASI_Mm01_00150428 predicted 300
6 SASI_Mm01_00150429 predicted 1313
7 SASI_Mm01_00150430 predicted 837
8 SASI_Mm01_00150431 predicted 701
9 SASI_Mm01_00150432 predicted 229
10 SASI_Mm01_00150433 predicted 1197
11 SASI_Mm01_00150427 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016519
AMBN MISSION shRNA Bacterial Glycerol Stock
ameloblastin (enamel matrix protein)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016519.4-603s21c1
Sequence:CCGGTGAGCTCCCAGGAGTAGATTTCTCGAGAAATCTACTCCTGGGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1390s1c1
Sequence:CCGGCATGACGCATGGCATTTCCAACTCGAGTTGGAAATGCCATGCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016519.4-1732s21c1
Sequence:CCGGTTACCAGCATGACACTATTATCTCGAGATAATAGTGTCATGCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-346s1c1
Sequence:CCGGCCAAGAGAACATGAAACTCAACTCGAGTTGAGTTTCATGTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1090s1c1
Sequence:CCGGCCAGCTTTCCTTACAGAGCTACTCGAGTAGCTCTGTAAGGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-204s1c1
Sequence:CCGGCCTTGAGACAATGAGACAGTTCTCGAGAACTGTCTCATTGTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-740s1c1
Sequence:CCGGGTTTGATTTCTCACGGACCAACTCGAGTTGGTCCGTGAGAAATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1252s1c1
Sequence:CCGGGATGTTTATAGGACCTACGATCTCGAGATCGTAGGTCCTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016519
AMBN MISSION shRNA shRNA Plasmid DNA
ameloblastin (enamel matrix protein)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016519.4-603s21c1
Sequence:CCGGTGAGCTCCCAGGAGTAGATTTCTCGAGAAATCTACTCCTGGGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1390s1c1
Sequence:CCGGCATGACGCATGGCATTTCCAACTCGAGTTGGAAATGCCATGCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016519.4-1732s21c1
Sequence:CCGGTTACCAGCATGACACTATTATCTCGAGATAATAGTGTCATGCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-346s1c1
Sequence:CCGGCCAAGAGAACATGAAACTCAACTCGAGTTGAGTTTCATGTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1090s1c1
Sequence:CCGGCCAGCTTTCCTTACAGAGCTACTCGAGTAGCTCTGTAAGGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-204s1c1
Sequence:CCGGCCTTGAGACAATGAGACAGTTCTCGAGAACTGTCTCATTGTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-740s1c1
Sequence:CCGGGTTTGATTTCTCACGGACCAACTCGAGTTGGTCCGTGAGAAATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1252s1c1
Sequence:CCGGGATGTTTATAGGACCTACGATCTCGAGATCGTAGGTCCTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016519
AMBN MISSION shRNA Lentiviral Transduction Particles
ameloblastin (enamel matrix protein)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016519.4-603s21c1
Sequence:CCGGTGAGCTCCCAGGAGTAGATTTCTCGAGAAATCTACTCCTGGGAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1390s1c1
Sequence:CCGGCATGACGCATGGCATTTCCAACTCGAGTTGGAAATGCCATGCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016519.4-1732s21c1
Sequence:CCGGTTACCAGCATGACACTATTATCTCGAGATAATAGTGTCATGCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-346s1c1
Sequence:CCGGCCAAGAGAACATGAAACTCAACTCGAGTTGAGTTTCATGTTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1090s1c1
Sequence:CCGGCCAGCTTTCCTTACAGAGCTACTCGAGTAGCTCTGTAAGGAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-204s1c1
Sequence:CCGGCCTTGAGACAATGAGACAGTTCTCGAGAACTGTCTCATTGTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-740s1c1
Sequence:CCGGGTTTGATTTCTCACGGACCAACTCGAGTTGGTCCGTGAGAAATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016519.2-1252s1c1
Sequence:CCGGGATGTTTATAGGACCTACGATCTCGAGATCGTAGGTCCTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009664
AMBN MISSION shRNA Bacterial Glycerol Stock
ameloblastin (enamel matrix protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009664.1-1463s1c1
Sequence:CCGGCCCTTCTTGCTTCCATTCTTACTCGAGTAAGAATGGAAGCAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-835s1c1
Sequence:CCGGCAAACCCTTAGGAGACTGAATCTCGAGATTCAGTCTCCTAAGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-665s1c1
Sequence:CCGGCACACAACAAAGCATCCGCTTCTCGAGAAGCGGATGCTTTGTTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-1131s1c1
Sequence:CCGGCCCTGAATTAGCAGAAGTTTACTCGAGTAAACTTCTGCTAATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-225s1c1
Sequence:CCGGCCTTGAGACAATGAGACAGTTCTCGAGAACTGTCTCATTGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009664
AMBN MISSION shRNA shRNA Plasmid DNA
ameloblastin (enamel matrix protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009664.1-1463s1c1
Sequence:CCGGCCCTTCTTGCTTCCATTCTTACTCGAGTAAGAATGGAAGCAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-835s1c1
Sequence:CCGGCAAACCCTTAGGAGACTGAATCTCGAGATTCAGTCTCCTAAGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-665s1c1
Sequence:CCGGCACACAACAAAGCATCCGCTTCTCGAGAAGCGGATGCTTTGTTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-1131s1c1
Sequence:CCGGCCCTGAATTAGCAGAAGTTTACTCGAGTAAACTTCTGCTAATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-225s1c1
Sequence:CCGGCCTTGAGACAATGAGACAGTTCTCGAGAACTGTCTCATTGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009664
AMBN MISSION shRNA Lentiviral Transduction Particles
ameloblastin (enamel matrix protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009664.1-1463s1c1
Sequence:CCGGCCCTTCTTGCTTCCATTCTTACTCGAGTAAGAATGGAAGCAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-835s1c1
Sequence:CCGGCAAACCCTTAGGAGACTGAATCTCGAGATTCAGTCTCCTAAGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-665s1c1
Sequence:CCGGCACACAACAAAGCATCCGCTTCTCGAGAAGCGGATGCTTTGTTGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-1131s1c1
Sequence:CCGGCCCTGAATTAGCAGAAGTTTACTCGAGTAAACTTCTGCTAATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009664.1-225s1c1
Sequence:CCGGCCTTGAGACAATGAGACAGTTCTCGAGAACTGTCTCATTGTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks