EMAIL THIS PAGE TO A FRIEND

AMBP

alpha-1-microglobulin/bikunin precursor

64 Gene Product Result for
Synonyms: A1M EDC1 HCP HI30 IATIL ITI ITIL ITILC UTI
Gene ID:
Human(259) Summary: This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008]
Mouse(11699) alpha 1 microglobulin/bikunin
Rat(25377) alpha-1-microglobulin/bikunin precursor
naked mole-rat(101726763) alpha-1-microglobulin/bikunin precursor
domestic guinea pig(100379539) alpha 1 microglobulin/bikunin
sheep(101104205) alpha-1-microglobulin/bikunin precursor
Zebrafish(394093) alpha-1-microglobulin/bikunin precursor
cow(280996) alpha-1-microglobulin/bikunin precursor
domestic cat(100510797) alpha-1-microglobulin/bikunin precursor
dog(481685) alpha-1-microglobulin/bikunin precursor
chicken(770795) alpha-1-microglobulin/bikunin precursor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405452 Anti-AMBP antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001497 Anti-AMBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1408545 Anti-AMBP antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2106570 Anti-AMBP antibody produced in rabbit affinity isolated antibody human, rabbit, rat, guinea pig, horse
ELISA, western blot pricing
WH0000259M1 Monoclonal Anti-AMBP antibody produced in mouse clone 3F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409073 Monoclonal Anti-AMBP antibody produced in mouse clone 4F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409074 Monoclonal Anti-AMBP antibody produced in mouse clone 4G2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409075 Monoclonal Anti-AMBP antibody produced in mouse clone 4F8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409076 Monoclonal Anti-AMBP antibody produced in mouse clone 4G12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409077 Monoclonal Anti-AMBP antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409078 Monoclonal Anti-AMBP antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409079 Monoclonal Anti-AMBP antibody produced in mouse clone 4A7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409080 Monoclonal Anti-AMBP antibody produced in mouse clone 4C10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409081 Monoclonal Anti-AMBP antibody produced in mouse clone 2E1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409082 Monoclonal Anti-AMBP antibody produced in mouse clone 4F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403546 Monoclonal Anti-AMBP, (C-terminal) antibody produced in mouse clone 1F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018891 MISSION® esiRNA esiRNA targeting human AMBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001633 Rosetta Predictions human pricing
NM_012901 Rosetta Predictions rat pricing
NM_007443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173506 predicted 617
2 SASI_Hs01_00173507 predicted 1050
3 SASI_Hs02_00332216 predicted 510
4 SASI_Hs01_00173510 predicted 981
5 SASI_Hs01_00173511 predicted 683
6 SASI_Hs01_00173512 predicted 628
7 SASI_Hs01_00173513 predicted 674
8 SASI_Hs01_00173514 predicted 734
9 SASI_Hs02_00332217 predicted 680
10 SASI_Hs01_00173515 predicted 1062
11 SASI_Hs01_00173508 predicted 656
12 SASI_Hs01_00173509 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104948 predicted 381
2 SASI_Rn01_00104949 predicted 534
3 SASI_Rn01_00104950 predicted 455
4 SASI_Rn01_00104951 predicted 669
5 SASI_Rn01_00104952 predicted 810
6 SASI_Rn01_00104953 predicted 387
7 SASI_Rn01_00104954 predicted 596
8 SASI_Rn02_00260429 predicted 594
9 SASI_Rn01_00104955 predicted 314
10 SASI_Rn01_00104956 predicted 275
11 SASI_Rn01_00104957 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126651 predicted 1003
2 SASI_Mm01_00126652 predicted 597
3 SASI_Mm01_00126653 predicted 759
4 SASI_Mm01_00126654 predicted 513
5 SASI_Mm01_00126655 predicted 868
6 SASI_Mm01_00126656 predicted 460
7 SASI_Mm02_00311611 predicted 557
8 SASI_Mm02_00311612 predicted 422
9 SASI_Mm02_00311613 predicted 736
10 SASI_Mm02_00311614 predicted 604
11 SASI_Mm01_00126649 predicted 815
12 SASI_Mm01_00126650 predicted 998
13 SASI_Mm01_00126657 predicted 936
14 SASI_Mm01_00126658 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001633
AMBP MISSION shRNA Bacterial Glycerol Stock
alpha-1-microglobulin/bikunin precursor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-595s1c1
Sequence:CCGGCCACACCAACTATGATGAGTACTCGAGTACTCATCATAGTTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-554s1c1
Sequence:CCGGCACAAATCCAAATGGAACATACTCGAGTATGTTCCATTTGGATTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-328s1c1
Sequence:CCGGCTTCAATATCTCTCGGATCTACTCGAGTAGATCCGAGAGATATTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-960s1c1
Sequence:CCGGGCAGGTATTTCTATAATGGTACTCGAGTACCATTATAGAAATACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-1027s1c1
Sequence:CCGGCGGTAACAACTTCGTCACAGACTCGAGTCTGTGACGAAGTTGTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-682s21c1
Sequence:CCGGGCCATCATGGACCCACCATTACTCGAGTAATGGTGGGTCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-1020s21c1
Sequence:CCGGTCCATGGCCTGTGAGACTTTCCTCGAGGAAAGTCTCACAGGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-841s21c1
Sequence:CCGGAGGAACCAGAGCCCATCTTAACTCGAGTTAAGATGGGCTCTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001633
AMBP MISSION shRNA shRNA Plasmid DNA
alpha-1-microglobulin/bikunin precursor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-595s1c1
Sequence:CCGGCCACACCAACTATGATGAGTACTCGAGTACTCATCATAGTTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-554s1c1
Sequence:CCGGCACAAATCCAAATGGAACATACTCGAGTATGTTCCATTTGGATTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-328s1c1
Sequence:CCGGCTTCAATATCTCTCGGATCTACTCGAGTAGATCCGAGAGATATTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-960s1c1
Sequence:CCGGGCAGGTATTTCTATAATGGTACTCGAGTACCATTATAGAAATACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-1027s1c1
Sequence:CCGGCGGTAACAACTTCGTCACAGACTCGAGTCTGTGACGAAGTTGTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-682s21c1
Sequence:CCGGGCCATCATGGACCCACCATTACTCGAGTAATGGTGGGTCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-1020s21c1
Sequence:CCGGTCCATGGCCTGTGAGACTTTCCTCGAGGAAAGTCTCACAGGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-841s21c1
Sequence:CCGGAGGAACCAGAGCCCATCTTAACTCGAGTTAAGATGGGCTCTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001633
AMBP MISSION shRNA Lentiviral Transduction Particles
alpha-1-microglobulin/bikunin precursor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-595s1c1
Sequence:CCGGCCACACCAACTATGATGAGTACTCGAGTACTCATCATAGTTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-554s1c1
Sequence:CCGGCACAAATCCAAATGGAACATACTCGAGTATGTTCCATTTGGATTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-328s1c1
Sequence:CCGGCTTCAATATCTCTCGGATCTACTCGAGTAGATCCGAGAGATATTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-960s1c1
Sequence:CCGGGCAGGTATTTCTATAATGGTACTCGAGTACCATTATAGAAATACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001633.2-1027s1c1
Sequence:CCGGCGGTAACAACTTCGTCACAGACTCGAGTCTGTGACGAAGTTGTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-682s21c1
Sequence:CCGGGCCATCATGGACCCACCATTACTCGAGTAATGGTGGGTCCATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-1020s21c1
Sequence:CCGGTCCATGGCCTGTGAGACTTTCCTCGAGGAAAGTCTCACAGGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001633.3-841s21c1
Sequence:CCGGAGGAACCAGAGCCCATCTTAACTCGAGTTAAGATGGGCTCTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007443
AMBP MISSION shRNA Bacterial Glycerol Stock
alpha-1-microglobulin/bikunin precursor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-454s1c1
Sequence:CCGGCCACACCAACTATGACGAATACTCGAGTATTCGTCATAGTTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-452s1c1
Sequence:CCGGGTCCACACCAACTATGACGAACTCGAGTTCGTCATAGTTGGTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-1056s1c1
Sequence:CCGGGCAACAAATTCTACTCTGAGACTCGAGTCTCAGAGTAGAATTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-848s1c1
Sequence:CCGGGCCTGCGAGACCTTTCAATATCTCGAGATATTGAAAGGTCTCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-978s1c1
Sequence:CCGGCCTTCATAAAGCTCTGGGCATCTCGAGATGCCCAGAGCTTTATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007443
AMBP MISSION shRNA shRNA Plasmid DNA
alpha-1-microglobulin/bikunin precursor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-454s1c1
Sequence:CCGGCCACACCAACTATGACGAATACTCGAGTATTCGTCATAGTTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-452s1c1
Sequence:CCGGGTCCACACCAACTATGACGAACTCGAGTTCGTCATAGTTGGTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-1056s1c1
Sequence:CCGGGCAACAAATTCTACTCTGAGACTCGAGTCTCAGAGTAGAATTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-848s1c1
Sequence:CCGGGCCTGCGAGACCTTTCAATATCTCGAGATATTGAAAGGTCTCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-978s1c1
Sequence:CCGGCCTTCATAAAGCTCTGGGCATCTCGAGATGCCCAGAGCTTTATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007443
AMBP MISSION shRNA Lentiviral Transduction Particles
alpha-1-microglobulin/bikunin precursor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-454s1c1
Sequence:CCGGCCACACCAACTATGACGAATACTCGAGTATTCGTCATAGTTGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-452s1c1
Sequence:CCGGGTCCACACCAACTATGACGAACTCGAGTTCGTCATAGTTGGTGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-1056s1c1
Sequence:CCGGGCAACAAATTCTACTCTGAGACTCGAGTCTCAGAGTAGAATTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-848s1c1
Sequence:CCGGGCCTGCGAGACCTTTCAATATCTCGAGATATTGAAAGGTCTCGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007443.1-978s1c1
Sequence:CCGGCCTTCATAAAGCTCTGGGCATCTCGAGATGCCCAGAGCTTTATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks