EMAIL THIS PAGE TO A FRIEND

AMBRA1

autophagy/beclin-1 regulator 1

137 Gene Product Result for
Synonyms: DCAF3 WDR94
Gene ID:
Mouse(228361) autophagy/beclin 1 regulator 1
Rat(59319) autophagy/beclin 1 regulator 1
Zebrafish(100332642) autophagy/beclin-1 regulator 1
chicken(423194) autophagy/beclin-1 regulator 1
domestic cat(101088613) autophagy/beclin-1 regulator 1
cow(517263) autophagy/beclin-1 regulator 1
Horse(100050652) autophagy/beclin-1 regulator 1
dog(483634) autophagy/beclin-1 regulator 1
sheep(101117963) autophagy/beclin-1 regulator 1
Domestic Rabbit(100349558) autophagy/beclin-1 regulator 1
domestic guinea pig(100716429) autophagy/beclin-1 regulator 1
naked mole-rat(101725050) autophagy/beclin-1 regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017749 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017749 Rosetta Predictions human pricing
NM_001134341 Rosetta Predictions rat pricing
XM_001069191 Rosetta Predictions rat pricing
XM_001073596 Rosetta Predictions rat pricing
XM_230288 Rosetta Predictions rat pricing
NM_001080754 Rosetta Predictions mouse pricing
NM_172669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116731 predicted 1692
2 SASI_Hs01_00116732 predicted 3642
3 SASI_Hs01_00116734 predicted 3207
4 SASI_Hs01_00116735 predicted 929
5 SASI_Hs01_00116736 predicted 2243
6 SASI_Hs01_00116738 predicted 745
7 SASI_Hs01_00116739 predicted 916
8 SASI_Hs01_00116740 predicted 2110
9 SASI_Hs02_00350558 predicted 2644
10 SASI_Hs02_00350559 predicted 2494
11 SASI_Hs01_00116733 predicted 2880
12 SASI_Hs01_00116737 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256209 predicted 2768
2 SASI_Rn02_00256210 predicted 822
3 SASI_Rn02_00256211 predicted 601
4 SASI_Rn02_00256212 predicted 936
5 SASI_Rn02_00256213 predicted 3005
6 SASI_Rn02_00256214 predicted 3479
7 SASI_Rn02_00256215 predicted 3913
8 SASI_Rn02_00256216 predicted 2918
9 SASI_Rn02_00256217 predicted 581
10 SASI_Rn02_00256218 predicted 3224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327183 predicted 3171
2 SASI_Rn02_00327184 predicted 1227
3 SASI_Rn02_00327185 predicted 995
4 SASI_Rn02_00327186 predicted 1331
5 SASI_Rn02_00327187 predicted 3400
6 SASI_Rn02_00327188 predicted 3315
7 SASI_Rn02_00327189 predicted 3668
8 SASI_Rn02_00327190 predicted 974
9 SASI_Rn02_00327191 predicted 1138
10 SASI_Rn02_00327192 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343286 predicted 825
2 SASI_Rn02_00343287 predicted 598
3 SASI_Rn02_00343288 predicted 941
4 SASI_Rn02_00343289 predicted 2740
5 SASI_Rn02_00343290 predicted 3214
6 SASI_Rn02_00343291 predicted 3643
7 SASI_Rn02_00343292 predicted 2650
8 SASI_Rn02_00343293 predicted 584
9 SASI_Rn02_00343294 predicted 2964
10 SASI_Rn02_00343295 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153948 predicted 1981
2 SASI_Rn01_00153949 predicted 2084
3 SASI_Rn01_00153950 predicted 1202
4 SASI_Rn01_00153951 predicted 4244
5 SASI_Rn01_00153952 predicted 330
6 SASI_Rn01_00153953 predicted 5150
7 SASI_Rn01_00153954 predicted 4097
8 SASI_Rn01_00153955 predicted 1729
9 SASI_Rn01_00153956 predicted 4460
10 SASI_Rn01_00153957 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293653 predicted 707
2 SASI_Mm02_00293654 predicted 599
3 SASI_Mm02_00293655 predicted 1363
4 SASI_Mm02_00293656 predicted 3627
5 SASI_Mm02_00293657 predicted 2646
6 SASI_Mm02_00293658 predicted 563
7 SASI_Mm02_00293659 predicted 580
8 SASI_Mm02_00293660 predicted 2104
9 SASI_Mm02_00293661 predicted 3208
10 SASI_Mm02_00293662 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193550 predicted 711
2 SASI_Mm02_00344378 predicted 594
3 SASI_Mm01_00193553 predicted 1632
4 SASI_Mm02_00344379 predicted 3905
5 SASI_Mm02_00344380 predicted 2910
6 SASI_Mm01_00193556 predicted 572
7 SASI_Mm01_00193557 predicted 574
8 SASI_Mm01_00193558 predicted 2382
9 SASI_Mm02_00344381 predicted 3480
10 SASI_Mm02_00344382 predicted 2026
11 SASI_Mm01_00193551 predicted 2701
12 SASI_Mm01_00193552 predicted 865
13 SASI_Mm01_00193554 predicted 539
14 SASI_Mm01_00193555 predicted 1886
15 SASI_Mm01_00193559 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017749
VALIDATED
AMBRA1 MISSION shRNA Bacterial Glycerol Stock
autophagy/beclin-1 regulator 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-515s21c1
Sequence:CCGGGTCCACGCTCTACCTTCTTATCTCGAGATAAGAAGGTAGAGCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2053s21c1
Sequence:CCGGGGCCACTGGGAAAGAATTTACCTCGAGGTAAATTCTTTCCCAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-715s21c1
Sequence:CCGGGAGGTTAGGATTTGGGATTTACTCGAGTAAATCCCAAATCCTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3157s21c1
Sequence:CCGGGGCTTGGCCTATGGTACTAACCTCGAGGTTAGTACCATAGGCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-1592s21c1
Sequence:CCGGGTGACCTGAGACGCTTCTTTCCTCGAGGAAAGAAGCGTCTCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4466s21c1
Sequence:CCGGAGCCTCTCTTCGTCGTCTTACCTCGAGGTAAGACGACGAAGAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2890s21c1
Sequence:CCGGATGCTCTACACCAAGCGATTTCTCGAGAAATCGCTTGGTGTAGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4316s21c1
Sequence:CCGGAGAGCCTCCAGAGAGTGAACACTCGAGTGTTCACTCTCTGGAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2714s21c1
Sequence:CCGGTCAGTAATGCTTCCGTGAATGCTCGAGCATTCACGGAAGCATTACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4137s21c1
Sequence:CCGGGTGGGCACAAGACAGTCAAATCTCGAGATTTGACTGTCTTGTGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3894s21c1
Sequence:CCGGCCACTGCGAGTTGACCAATAACTCGAGTTATTGGTCAACTCGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3975s21c1
Sequence:CCGGACGGAACAGGTAGAGACAAACCTCGAGGTTTGTCTCTACCTGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017749.2-3340s1c1
Sequence:CCGGCTGATGAATGCCATTGGGCTTCTCGAGAAGCCCAATGGCATTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017749.2-4825s1c1
Sequence:CCGGGCATGTGGACTCTTAACTGTACTCGAGTACAGTTAAGAGTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017749.2-2247s1c1
Sequence:CCGGGAGATTATCTCCTGCTGCATACTCGAGTATGCAGCAGGAGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017749.2-4268s1c1
Sequence:CCGGCCCACTTTCTCCTAGTAACATCTCGAGATGTTACTAGGAGAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017749.2-2181s1c1
Sequence:CCGGCCTCATTTCATTATCCCGTTACTCGAGTAACGGGATAATGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017749
VALIDATED
AMBRA1 MISSION shRNA shRNA Plasmid DNA
autophagy/beclin-1 regulator 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-515s21c1
Sequence:CCGGGTCCACGCTCTACCTTCTTATCTCGAGATAAGAAGGTAGAGCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2053s21c1
Sequence:CCGGGGCCACTGGGAAAGAATTTACCTCGAGGTAAATTCTTTCCCAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-715s21c1
Sequence:CCGGGAGGTTAGGATTTGGGATTTACTCGAGTAAATCCCAAATCCTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3157s21c1
Sequence:CCGGGGCTTGGCCTATGGTACTAACCTCGAGGTTAGTACCATAGGCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-1592s21c1
Sequence:CCGGGTGACCTGAGACGCTTCTTTCCTCGAGGAAAGAAGCGTCTCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4466s21c1
Sequence:CCGGAGCCTCTCTTCGTCGTCTTACCTCGAGGTAAGACGACGAAGAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2890s21c1
Sequence:CCGGATGCTCTACACCAAGCGATTTCTCGAGAAATCGCTTGGTGTAGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4316s21c1
Sequence:CCGGAGAGCCTCCAGAGAGTGAACACTCGAGTGTTCACTCTCTGGAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2714s21c1
Sequence:CCGGTCAGTAATGCTTCCGTGAATGCTCGAGCATTCACGGAAGCATTACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4137s21c1
Sequence:CCGGGTGGGCACAAGACAGTCAAATCTCGAGATTTGACTGTCTTGTGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3894s21c1
Sequence:CCGGCCACTGCGAGTTGACCAATAACTCGAGTTATTGGTCAACTCGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3975s21c1
Sequence:CCGGACGGAACAGGTAGAGACAAACCTCGAGGTTTGTCTCTACCTGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017749.2-3340s1c1
Sequence:CCGGCTGATGAATGCCATTGGGCTTCTCGAGAAGCCCAATGGCATTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017749.2-4825s1c1
Sequence:CCGGGCATGTGGACTCTTAACTGTACTCGAGTACAGTTAAGAGTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017749.2-2247s1c1
Sequence:CCGGGAGATTATCTCCTGCTGCATACTCGAGTATGCAGCAGGAGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017749.2-4268s1c1
Sequence:CCGGCCCACTTTCTCCTAGTAACATCTCGAGATGTTACTAGGAGAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017749.2-2181s1c1
Sequence:CCGGCCTCATTTCATTATCCCGTTACTCGAGTAACGGGATAATGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017749
VALIDATED
AMBRA1 MISSION shRNA Lentiviral Transduction Particles
autophagy/beclin-1 regulator 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-515s21c1
Sequence:CCGGGTCCACGCTCTACCTTCTTATCTCGAGATAAGAAGGTAGAGCGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2053s21c1
Sequence:CCGGGGCCACTGGGAAAGAATTTACCTCGAGGTAAATTCTTTCCCAGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-715s21c1
Sequence:CCGGGAGGTTAGGATTTGGGATTTACTCGAGTAAATCCCAAATCCTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3157s21c1
Sequence:CCGGGGCTTGGCCTATGGTACTAACCTCGAGGTTAGTACCATAGGCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-1592s21c1
Sequence:CCGGGTGACCTGAGACGCTTCTTTCCTCGAGGAAAGAAGCGTCTCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4466s21c1
Sequence:CCGGAGCCTCTCTTCGTCGTCTTACCTCGAGGTAAGACGACGAAGAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2890s21c1
Sequence:CCGGATGCTCTACACCAAGCGATTTCTCGAGAAATCGCTTGGTGTAGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4316s21c1
Sequence:CCGGAGAGCCTCCAGAGAGTGAACACTCGAGTGTTCACTCTCTGGAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-2714s21c1
Sequence:CCGGTCAGTAATGCTTCCGTGAATGCTCGAGCATTCACGGAAGCATTACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017749.2-4137s21c1
Sequence:CCGGGTGGGCACAAGACAGTCAAATCTCGAGATTTGACTGTCTTGTGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3894s21c1
Sequence:CCGGCCACTGCGAGTTGACCAATAACTCGAGTTATTGGTCAACTCGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017749.2-3975s21c1
Sequence:CCGGACGGAACAGGTAGAGACAAACCTCGAGGTTTGTCTCTACCTGTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017749.2-3340s1c1
Sequence:CCGGCTGATGAATGCCATTGGGCTTCTCGAGAAGCCCAATGGCATTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017749.2-4825s1c1
Sequence:CCGGGCATGTGGACTCTTAACTGTACTCGAGTACAGTTAAGAGTCCACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017749.2-2247s1c1
Sequence:CCGGGAGATTATCTCCTGCTGCATACTCGAGTATGCAGCAGGAGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167886    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017749.2-4268s1c1
Sequence:CCGGCCCACTTTCTCCTAGTAACATCTCGAGATGTTACTAGGAGAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017749.2-2181s1c1
Sequence:CCGGCCTCATTTCATTATCCCGTTACTCGAGTAACGGGATAATGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172669
AMBRA1 MISSION shRNA Bacterial Glycerol Stock
autophagy/beclin-1 regulator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172669.2-4101s1c1
Sequence:CCGGGCACTGCAATGTGACCAATAACTCGAGTTATTGGTCACATTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-1072s1c1
Sequence:CCGGGCACAGTACAAGATTCTGCTACTCGAGTAGCAGAATCTTGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-2688s1c1
Sequence:CCGGGCACCTTCACTTGGACGATTTCTCGAGAAATCGTCCAAGTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-1777s1c1
Sequence:CCGGGCATTCGCCATGAGCTTCAATCTCGAGATTGAAGCTCATGGCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-2260s1c1
Sequence:CCGGGCCACTGGGAACGCATTTATACTCGAGTATAAATGCGTTCCCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172669
AMBRA1 MISSION shRNA shRNA Plasmid DNA
autophagy/beclin-1 regulator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172669.2-4101s1c1
Sequence:CCGGGCACTGCAATGTGACCAATAACTCGAGTTATTGGTCACATTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-1072s1c1
Sequence:CCGGGCACAGTACAAGATTCTGCTACTCGAGTAGCAGAATCTTGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-2688s1c1
Sequence:CCGGGCACCTTCACTTGGACGATTTCTCGAGAAATCGTCCAAGTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-1777s1c1
Sequence:CCGGGCATTCGCCATGAGCTTCAATCTCGAGATTGAAGCTCATGGCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-2260s1c1
Sequence:CCGGGCCACTGGGAACGCATTTATACTCGAGTATAAATGCGTTCCCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172669
AMBRA1 MISSION shRNA Lentiviral Transduction Particles
autophagy/beclin-1 regulator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190777    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172669.2-4101s1c1
Sequence:CCGGGCACTGCAATGTGACCAATAACTCGAGTTATTGGTCACATTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-1072s1c1
Sequence:CCGGGCACAGTACAAGATTCTGCTACTCGAGTAGCAGAATCTTGTACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-2688s1c1
Sequence:CCGGGCACCTTCACTTGGACGATTTCTCGAGAAATCGTCCAAGTGAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-1777s1c1
Sequence:CCGGGCATTCGCCATGAGCTTCAATCTCGAGATTGAAGCTCATGGCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172669.2-2260s1c1
Sequence:CCGGGCCACTGGGAACGCATTTATACTCGAGTATAAATGCGTTCCCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks