EMAIL THIS PAGE TO A FRIEND

AMD1

adenosylmethionine decarboxylase 1

172 Gene Product Result for
Synonyms: ADOMETDC AMD SAMDC
UniProtKB ID: P17707, E1P5F7, Q5VXN4, Q5VXN6, Q9BWK4
Gene ID:
Human(262) Summary: This gene encodes an important intermediate enzyme in polyamine biosynthesis. The polyamines spermine, spermidine, and putrescine are low-molecular-weight aliphatic amines essential for cellular proliferation and tumor promotion. Two alternatively spliced transcript variants that encode different proteins have been identified. Pseudogenes of this gene are found on chromosomes 5, 6, 10, X and Y.[provided by RefSeq, Jul 2010]
Mouse(11702) S-adenosylmethionine decarboxylase 1
Rat(81640) adenosylmethionine decarboxylase 1
naked mole-rat(101711473) adenosylmethionine decarboxylase 1
domestic guinea pig(100730062) adenosylmethionine decarboxylase 1
sheep(101110851) adenosylmethionine decarboxylase 1
Zebrafish(792097) adenosylmethionine decarboxylase 1
chicken(421755) adenosylmethionine decarboxylase 1
cow(280997) adenosylmethionine decarboxylase 1
dog(481960) adenosylmethionine decarboxylase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033059 Rosetta Predictions human pricing
NM_001634 Rosetta Predictions human pricing
NM_031011 Rosetta Predictions rat pricing
NM_009665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126454 predicted 1217
2 SASI_Hs01_00126455 predicted 1133
3 SASI_Hs01_00126463 predicted 1297
4 SASI_Hs02_00307995 predicted 1201
5 SASI_Hs02_00307996 predicted 1180
6 SASI_Hs02_00307997 predicted 650
7 SASI_Hs01_00126457 predicted 637
8 SASI_Hs01_00126458 predicted 855
9 SASI_Hs01_00126459 predicted 1283
10 SASI_Hs01_00126460 predicted 705
11 SASI_Hs01_00126456 predicted 710
12 SASI_Hs01_00126461 predicted 937
13 SASI_Hs01_00126462 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063153 predicted 1533
2 SASI_Hs01_00063154 predicted 1451
3 SASI_Hs01_00063162 predicted 1611
4 SASI_Hs02_00332218 predicted 1523
5 SASI_Hs02_00332219 predicted 1496
6 SASI_Hs02_00332220 predicted 966
7 SASI_Hs01_00063156 predicted 950
8 SASI_Hs01_00063157 predicted 1165
9 SASI_Hs01_00063158 predicted 1601
10 SASI_Hs01_00063159 predicted 1025
11 SASI_Hs01_00063155 predicted 1030
12 SASI_Hs01_00063160 predicted 1256
13 SASI_Hs01_00063161 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085407 predicted 959
2 SASI_Rn01_00085409 predicted 898
3 SASI_Rn01_00085410 predicted 993
4 SASI_Rn01_00085411 predicted 905
5 SASI_Rn01_00085412 predicted 728
6 SASI_Rn01_00085413 predicted 864
7 SASI_Rn01_00085414 predicted 975
8 SASI_Rn01_00085415 predicted 415
9 SASI_Rn01_00085416 predicted 966
10 SASI_Rn02_00264201 predicted 833
11 SASI_Rn01_00085408 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316683 predicted 729
2 SASI_Mm01_00110678 predicted 701
3 SASI_Mm02_00316684 predicted 870
4 SASI_Mm02_00316685 predicted 834
5 SASI_Mm02_00316686 predicted 478
6 SASI_Mm02_00316687 predicted 873
7 SASI_Mm01_00110679 predicted 747
8 SASI_Mm02_00316688 predicted 702
9 SASI_Mm02_00316689 predicted 824
10 SASI_Mm02_00316690 predicted 794
11 SASI_Mm01_00110677 predicted 694
12 SASI_Mm01_00110680 predicted 1223
13 SASI_Mm01_00110681 predicted 781
14 SASI_Mm01_00110682 predicted 611
15 SASI_Mm01_00110683 predicted 1005
16 SASI_Mm01_00110684 predicted 953
17 SASI_Mm01_00110685 predicted 1034
18 SASI_Mm01_00110686 predicted 1169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001634
VALIDATED
AMD1 MISSION shRNA Bacterial Glycerol Stock
adenosylmethionine decarboxylase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-2422s1c1
Sequence:CCGGCCCATTAAGTAGTGTTCTATACTCGAGTATAGAACACTACTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001634.3-836s1c1
Sequence:CCGGGCCAGATCAAACCTTGGAAATCTCGAGATTTCCAAGGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-1024s1c1
Sequence:CCGGCGGATGGAACTTATTGGACTACTCGAGTAGTCCAATAAGTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-534s1c1
Sequence:CCGGGTCTCCAAGAGACGTTTCATTCTCGAGAATGAAACGTCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-1026s1c1
Sequence:CCGGGATGGAACTTATTGGACTATTCTCGAGAATAGTCCAATAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001634.4-459s21c1
Sequence:CCGGATGTGCAATGTTCAATCATAACTCGAGTTATGATTGAACATTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-1638s21c1
Sequence:CCGGGGTTTATGCACAGTGTAATATCTCGAGATATTACACTGTGCATAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-1028s21c1
Sequence:CCGGGATGGAACTTATTGGACTATTCTCGAGAATAGTCCAATAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001634.4-838s21c1
Sequence:CCGGGCCAGATCAAACCTTGGAAATCTCGAGATTTCCAAGGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-782s21c1
Sequence:CCGGTCTGACTGTTGGTACTTATATCTCGAGATATAAGTACCAACAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-536s21c1
Sequence:CCGGGTCTCCAAGAGACGTTTCATTCTCGAGAATGAAACGTCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001634
VALIDATED
AMD1 MISSION shRNA shRNA Plasmid DNA
adenosylmethionine decarboxylase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-2422s1c1
Sequence:CCGGCCCATTAAGTAGTGTTCTATACTCGAGTATAGAACACTACTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001634.3-836s1c1
Sequence:CCGGGCCAGATCAAACCTTGGAAATCTCGAGATTTCCAAGGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-1024s1c1
Sequence:CCGGCGGATGGAACTTATTGGACTACTCGAGTAGTCCAATAAGTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-534s1c1
Sequence:CCGGGTCTCCAAGAGACGTTTCATTCTCGAGAATGAAACGTCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-1026s1c1
Sequence:CCGGGATGGAACTTATTGGACTATTCTCGAGAATAGTCCAATAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001634.4-459s21c1
Sequence:CCGGATGTGCAATGTTCAATCATAACTCGAGTTATGATTGAACATTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-1638s21c1
Sequence:CCGGGGTTTATGCACAGTGTAATATCTCGAGATATTACACTGTGCATAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-1028s21c1
Sequence:CCGGGATGGAACTTATTGGACTATTCTCGAGAATAGTCCAATAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001634.4-838s21c1
Sequence:CCGGGCCAGATCAAACCTTGGAAATCTCGAGATTTCCAAGGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-782s21c1
Sequence:CCGGTCTGACTGTTGGTACTTATATCTCGAGATATAAGTACCAACAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-536s21c1
Sequence:CCGGGTCTCCAAGAGACGTTTCATTCTCGAGAATGAAACGTCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001634
VALIDATED
AMD1 MISSION shRNA Lentiviral Transduction Particles
adenosylmethionine decarboxylase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-2422s1c1
Sequence:CCGGCCCATTAAGTAGTGTTCTATACTCGAGTATAGAACACTACTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001634.3-836s1c1
Sequence:CCGGGCCAGATCAAACCTTGGAAATCTCGAGATTTCCAAGGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-1024s1c1
Sequence:CCGGCGGATGGAACTTATTGGACTACTCGAGTAGTCCAATAAGTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-534s1c1
Sequence:CCGGGTCTCCAAGAGACGTTTCATTCTCGAGAATGAAACGTCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001634.3-1026s1c1
Sequence:CCGGGATGGAACTTATTGGACTATTCTCGAGAATAGTCCAATAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001634.4-459s21c1
Sequence:CCGGATGTGCAATGTTCAATCATAACTCGAGTTATGATTGAACATTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-1638s21c1
Sequence:CCGGGGTTTATGCACAGTGTAATATCTCGAGATATTACACTGTGCATAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-1028s21c1
Sequence:CCGGGATGGAACTTATTGGACTATTCTCGAGAATAGTCCAATAAGTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001634.4-838s21c1
Sequence:CCGGGCCAGATCAAACCTTGGAAATCTCGAGATTTCCAAGGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-782s21c1
Sequence:CCGGTCTGACTGTTGGTACTTATATCTCGAGATATAAGTACCAACAGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001634.4-536s21c1
Sequence:CCGGGTCTCCAAGAGACGTTTCATTCTCGAGAATGAAACGTCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009665
VALIDATED
AMD1 MISSION shRNA Bacterial Glycerol Stock
adenosylmethionine decarboxylase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-3024s1c1
Sequence:CCGGGCCTAGAACAACTGTAGGTAACTCGAGTTACCTACAGTTGTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009665.2-1019s1c1
Sequence:CCGGCGGATGGAACATATTGGACTACTCGAGTAGTCCAATATGTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-461s1c1
Sequence:CCGGGCTCAATCATAAGTGTGACAACTCGAGTTGTCACACTTATGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-1211s1c1
Sequence:CCGGCCCAGAAGATTGACGGCTTTACTCGAGTAAAGCCGTCAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009665.2-831s1c1
Sequence:CCGGGCCAGATCAAACACTGGAAATCTCGAGATTTCCAGTGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009665
VALIDATED
AMD1 MISSION shRNA shRNA Plasmid DNA
adenosylmethionine decarboxylase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-3024s1c1
Sequence:CCGGGCCTAGAACAACTGTAGGTAACTCGAGTTACCTACAGTTGTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009665.2-1019s1c1
Sequence:CCGGCGGATGGAACATATTGGACTACTCGAGTAGTCCAATATGTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-461s1c1
Sequence:CCGGGCTCAATCATAAGTGTGACAACTCGAGTTGTCACACTTATGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-1211s1c1
Sequence:CCGGCCCAGAAGATTGACGGCTTTACTCGAGTAAAGCCGTCAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009665.2-831s1c1
Sequence:CCGGGCCAGATCAAACACTGGAAATCTCGAGATTTCCAGTGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009665
VALIDATED
AMD1 MISSION shRNA Lentiviral Transduction Particles
adenosylmethionine decarboxylase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-3024s1c1
Sequence:CCGGGCCTAGAACAACTGTAGGTAACTCGAGTTACCTACAGTTGTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009665.2-1019s1c1
Sequence:CCGGCGGATGGAACATATTGGACTACTCGAGTAGTCCAATATGTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-461s1c1
Sequence:CCGGGCTCAATCATAAGTGTGACAACTCGAGTTGTCACACTTATGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009665.2-1211s1c1
Sequence:CCGGCCCAGAAGATTGACGGCTTTACTCGAGTAAAGCCGTCAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009665.2-831s1c1
Sequence:CCGGGCCAGATCAAACACTGGAAATCTCGAGATTTCCAGTGTTTGATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks