EMAIL THIS PAGE TO A FRIEND

AMDHD1

amidohydrolase domain containing 1

79 Gene Product Result for
UniProtKB ID: Q96NU7, A8K463, Q68CI8
Gene ID:
Mouse(71761) amidohydrolase domain containing 1
Rat(299735) amidohydrolase domain containing 1
sheep(101121504) amidohydrolase domain containing 1
naked mole-rat(101700746) amidohydrolase domain containing 1
domestic guinea pig(100721087) amidohydrolase domain containing 1
Zebrafish(402826) amidohydrolase domain containing 1
dog(475432) amidohydrolase domain containing 1
cow(505315) amidohydrolase domain containing 1
domestic cat(101083436) amidohydrolase domain containing 1
chicken(417917) amidohydrolase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152435 Rosetta Predictions human pricing
XM_001080313 Rosetta Predictions rat pricing
XM_235065 Rosetta Predictions rat pricing
XM_125854 Rosetta Predictions mouse pricing
XM_990660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070732 predicted 1605
2 SASI_Hs01_00070733 predicted 1324
3 SASI_Hs02_00366177 predicted 1267
4 SASI_Hs02_00366178 predicted 270
5 SASI_Hs01_00070734 predicted 372
6 SASI_Hs01_00070736 predicted 1467
7 SASI_Hs01_00070737 predicted 596
8 SASI_Hs01_00070738 predicted 1403
9 SASI_Hs01_00070739 predicted 1629
10 SASI_Hs01_00070741 predicted 1323
11 SASI_Hs01_00070735 predicted 1220
12 SASI_Hs01_00070740 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367558 predicted 1204
2 SASI_Rn02_00367559 predicted 612
3 SASI_Rn02_00367560 predicted 700
4 SASI_Rn02_00367561 predicted 1221
5 SASI_Rn02_00367562 predicted 926
6 SASI_Rn02_00367563 predicted 896
7 SASI_Rn02_00367564 predicted 572
8 SASI_Rn02_00367565 predicted 241
9 SASI_Rn02_00367566 predicted 1105
10 SASI_Rn02_00367567 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388951 predicted 1259
2 SASI_Rn02_00388952 predicted 1551
3 SASI_Rn02_00388953 predicted 1521
4 SASI_Rn02_00388954 predicted 1247
5 SASI_Rn02_00388955 predicted 1282
6 SASI_Rn02_00388956 predicted 1518
7 SASI_Rn02_00388957 predicted 1156
8 SASI_Rn02_00388958 predicted 1495
9 SASI_Rn02_00388959 predicted 1231
10 SASI_Rn02_00388960 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239262 predicted 304
2 SASI_Mm02_00424115 predicted 344
3 SASI_Mm01_00239265 predicted 266
4 SASI_Mm02_00424116 predicted 1276
5 SASI_Mm02_00424117 predicted 382
6 SASI_Mm02_00424118 predicted 1282
7 SASI_Mm02_00424119 predicted 1272
8 SASI_Mm02_00424120 predicted 335
9 SASI_Mm02_00424121 predicted 341
10 SASI_Mm02_00424122 predicted 392
11 SASI_Mm01_00239263 predicted 669
12 SASI_Mm01_00239264 predicted 617
13 SASI_Mm01_00239266 predicted 1027
14 SASI_Mm01_00239267 predicted 1246
15 SASI_Mm01_00239268 predicted 1323
16 SASI_Mm01_00239269 predicted 1427
17 SASI_Mm01_00239270 predicted 1406
18 SASI_Mm01_00239271 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450356 predicted 300
2 SASI_Mm02_00450357 predicted 668
3 SASI_Mm02_00450358 predicted 1782
4 SASI_Mm02_00450359 predicted 896
5 SASI_Mm02_00450360 predicted 268
6 SASI_Mm02_00450361 predicted 1020
7 SASI_Mm02_00450362 predicted 1237
8 SASI_Mm02_00450363 predicted 557
9 SASI_Mm02_00450364 predicted 981
10 SASI_Mm02_00450365 predicted 1781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152435
VALIDATED
AMDHD1 MISSION shRNA Bacterial Glycerol Stock
amidohydrolase domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152435.1-1202s1c1
Sequence:CCGGGCCACCATCAATGCAGCTTATCTCGAGATAAGCTGCATTGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-781s1c1
Sequence:CCGGCGTGGACAATATAGACGTATTCTCGAGAATACGTCTATATTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-384s1c1
Sequence:CCGGCTGGTGAAAGAGTTCACGAATCTCGAGATTCGTGAACTCTTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152435.1-1031s1c1
Sequence:CCGGGCCTACATGCTGAGACTGAAACTCGAGTTTCAGTCTCAGCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-713s1c1
Sequence:CCGGGCTGCTGATGACATCATCAATCTCGAGATTGATGATGTCATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1581s21c1
Sequence:CCGGGGTAAACCTATTGTGATTAAACTCGAGTTTAATCACAATAGGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-563s21c1
Sequence:CCGGGTGGAGTGCAAGAGTGGATATCTCGAGATATCCACTCTTGCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1558s21c1
Sequence:CCGGCACATGCATTTGACATATAAACTCGAGTTTATATGTCAAATGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-860s21c1
Sequence:CCGGGATATAGGGTTACAGATTAACCTCGAGGTTAATCTGTAACCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1610s21c1
Sequence:CCGGACATCCAATTAGTTCACAAATCTCGAGATTTGTGAACTAATTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-1070s21c1
Sequence:CCGGATGTTAGATGAAGGAGTAATACTCGAGTATTACTCCTTCATCTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152435
VALIDATED
AMDHD1 MISSION shRNA shRNA Plasmid DNA
amidohydrolase domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152435.1-1202s1c1
Sequence:CCGGGCCACCATCAATGCAGCTTATCTCGAGATAAGCTGCATTGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-781s1c1
Sequence:CCGGCGTGGACAATATAGACGTATTCTCGAGAATACGTCTATATTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-384s1c1
Sequence:CCGGCTGGTGAAAGAGTTCACGAATCTCGAGATTCGTGAACTCTTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152435.1-1031s1c1
Sequence:CCGGGCCTACATGCTGAGACTGAAACTCGAGTTTCAGTCTCAGCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-713s1c1
Sequence:CCGGGCTGCTGATGACATCATCAATCTCGAGATTGATGATGTCATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1581s21c1
Sequence:CCGGGGTAAACCTATTGTGATTAAACTCGAGTTTAATCACAATAGGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-563s21c1
Sequence:CCGGGTGGAGTGCAAGAGTGGATATCTCGAGATATCCACTCTTGCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1558s21c1
Sequence:CCGGCACATGCATTTGACATATAAACTCGAGTTTATATGTCAAATGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-860s21c1
Sequence:CCGGGATATAGGGTTACAGATTAACCTCGAGGTTAATCTGTAACCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1610s21c1
Sequence:CCGGACATCCAATTAGTTCACAAATCTCGAGATTTGTGAACTAATTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-1070s21c1
Sequence:CCGGATGTTAGATGAAGGAGTAATACTCGAGTATTACTCCTTCATCTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152435
VALIDATED
AMDHD1 MISSION shRNA Lentiviral Transduction Particles
amidohydrolase domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152435.1-1202s1c1
Sequence:CCGGGCCACCATCAATGCAGCTTATCTCGAGATAAGCTGCATTGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-781s1c1
Sequence:CCGGCGTGGACAATATAGACGTATTCTCGAGAATACGTCTATATTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-384s1c1
Sequence:CCGGCTGGTGAAAGAGTTCACGAATCTCGAGATTCGTGAACTCTTTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152435.1-1031s1c1
Sequence:CCGGGCCTACATGCTGAGACTGAAACTCGAGTTTCAGTCTCAGCATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152435.1-713s1c1
Sequence:CCGGGCTGCTGATGACATCATCAATCTCGAGATTGATGATGTCATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1581s21c1
Sequence:CCGGGGTAAACCTATTGTGATTAAACTCGAGTTTAATCACAATAGGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-563s21c1
Sequence:CCGGGTGGAGTGCAAGAGTGGATATCTCGAGATATCCACTCTTGCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1558s21c1
Sequence:CCGGCACATGCATTTGACATATAAACTCGAGTTTATATGTCAAATGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-860s21c1
Sequence:CCGGGATATAGGGTTACAGATTAACCTCGAGGTTAATCTGTAACCCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152435.2-1610s21c1
Sequence:CCGGACATCCAATTAGTTCACAAATCTCGAGATTTGTGAACTAATTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152435.2-1070s21c1
Sequence:CCGGATGTTAGATGAAGGAGTAATACTCGAGTATTACTCCTTCATCTAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125854
AMDHD1 MISSION shRNA Bacterial Glycerol Stock
amidohydrolase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-1190s1c1
Sequence:CCGGCGGATCTTTGGAAGTTGGCAACTCGAGTTGCCAACTTCCAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-692s1c1
Sequence:CCGGGCTGAAGGAACTCAGCAGAAACTCGAGTTTCTGCTGAGTTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-341s1c1
Sequence:CCGGCCACGAGTTTGCAATGAAGTTCTCGAGAACTTCATTGCAAACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-717s1c1
Sequence:CCGGGACCTGCATGTTGACAACATACTCGAGTATGTTGTCAACATGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-1146s1c1
Sequence:CCGGGCCACCATCAACGCGGCTTATCTCGAGATAAGCCGCGTTGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125854
AMDHD1 MISSION shRNA shRNA Plasmid DNA
amidohydrolase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-1190s1c1
Sequence:CCGGCGGATCTTTGGAAGTTGGCAACTCGAGTTGCCAACTTCCAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-692s1c1
Sequence:CCGGGCTGAAGGAACTCAGCAGAAACTCGAGTTTCTGCTGAGTTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-341s1c1
Sequence:CCGGCCACGAGTTTGCAATGAAGTTCTCGAGAACTTCATTGCAAACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-717s1c1
Sequence:CCGGGACCTGCATGTTGACAACATACTCGAGTATGTTGTCAACATGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-1146s1c1
Sequence:CCGGGCCACCATCAACGCGGCTTATCTCGAGATAAGCCGCGTTGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125854
AMDHD1 MISSION shRNA Lentiviral Transduction Particles
amidohydrolase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-1190s1c1
Sequence:CCGGCGGATCTTTGGAAGTTGGCAACTCGAGTTGCCAACTTCCAAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-692s1c1
Sequence:CCGGGCTGAAGGAACTCAGCAGAAACTCGAGTTTCTGCTGAGTTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-341s1c1
Sequence:CCGGCCACGAGTTTGCAATGAAGTTCTCGAGAACTTCATTGCAAACTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-717s1c1
Sequence:CCGGGACCTGCATGTTGACAACATACTCGAGTATGTTGTCAACATGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125854.2-1146s1c1
Sequence:CCGGGCCACCATCAACGCGGCTTATCTCGAGATAAGCCGCGTTGATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks