EMAIL THIS PAGE TO A FRIEND

AMDHD2

amidohydrolase domain containing 2

50 Gene Product Result for
UniProtKB ID: Q9Y303, B4DL77, Q8WV54
Gene ID:
Mouse(245847) amidohydrolase domain containing 2
Rat(302972) amidohydrolase domain containing 2
Zebrafish(402981) amidohydrolase domain containing 2
chicken(770465) amidohydrolase domain containing 2
cow(521401) amidohydrolase domain containing 2
domestic cat(101080421) amidohydrolase domain containing 2
dog(479876) amidohydrolase domain containing 2
domestic guinea pig(100734856) amidohydrolase domain containing 2
naked mole-rat(101709592) amidohydrolase domain containing 2
sheep(101116953) amidohydrolase domain containing 2
Domestic Rabbit(100345391) amidohydrolase domain containing 2
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015944 Rosetta Predictions human pricing
NM_001024990 Rosetta Predictions rat pricing
NM_172935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173166 predicted 377
2 SASI_Hs01_00173167 predicted 252
3 SASI_Hs01_00173168 predicted 252
4 SASI_Hs01_00173169 predicted 1242
5 SASI_Hs01_00173170 predicted 1258
6 SASI_Hs02_00348582 predicted 813
7 SASI_Hs01_00173172 predicted 241
8 SASI_Hs01_00173173 predicted 242
9 SASI_Hs01_00173175 predicted 220
10 SASI_Hs02_00348583 predicted 225
11 SASI_Hs01_00173171 predicted 1079
12 SASI_Hs01_00173174 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095771 predicted 1245
2 SASI_Rn01_00095772 predicted 501
3 SASI_Rn01_00095773 predicted 1181
4 SASI_Rn02_00202881 predicted 401
5 SASI_Rn01_00095775 predicted 1240
6 SASI_Rn01_00095776 predicted 288
7 SASI_Rn01_00095777 predicted 857
8 SASI_Rn01_00095778 predicted 603
9 SASI_Rn01_00095779 predicted 250
10 SASI_Rn02_00202882 predicted 288
11 SASI_Rn01_00095774 predicted 660
12 SASI_Rn01_00095780 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087900 predicted 861
2 SASI_Mm01_00087901 predicted 284
3 SASI_Mm02_00344940 predicted 980
4 SASI_Mm01_00087903 predicted 492
5 SASI_Mm01_00087904 predicted 401
6 SASI_Mm01_00087905 predicted 602
7 SASI_Mm01_00087906 predicted 838
8 SASI_Mm01_00087908 predicted 1066
9 SASI_Mm01_00087909 predicted 1199
10 SASI_Mm02_00344941 predicted 664
11 SASI_Mm01_00087902 predicted 1020
12 SASI_Mm01_00087907 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015944
VALIDATED
AMDHD2 MISSION shRNA Bacterial Glycerol Stock
amidohydrolase domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-1356s21c1
Sequence:CCGGACGTCCAGGCCACCTACATCTCTCGAGAGATGTAGGTGGCCTGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-470s21c1
Sequence:CCGGATCCCTGTGAAGAGTGGTGGTCTCGAGACCACCACTCTTCACAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-1313s21c1
Sequence:CCGGTTTGGTGCTGACGCAGACTTCCTCGAGGAAGTCTGCGTCAGCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015944.2-252s1c1
Sequence:CCGGCGGTGGATTTGGTGTTGACTTCTCGAGAAGTCAACACCAAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015944.2-240s1c1
Sequence:CCGGCGTGCAGATCAACGGTGGATTCTCGAGAATCCACCGTTGATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-72s1c1
Sequence:CCGGCCAGTTCACTAACTGCCGGATCTCGAGATCCGGCAGTTAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-379s1c1
Sequence:CCGGGAGGTTTATCACAAGGTTGTTCTCGAGAACAACCTTGTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-814s1c1
Sequence:CCGGTGCATCTTCTATGGGATGATTCTCGAGAATCATCCCATAGAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015944
VALIDATED
AMDHD2 MISSION shRNA shRNA Plasmid DNA
amidohydrolase domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-1356s21c1
Sequence:CCGGACGTCCAGGCCACCTACATCTCTCGAGAGATGTAGGTGGCCTGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-470s21c1
Sequence:CCGGATCCCTGTGAAGAGTGGTGGTCTCGAGACCACCACTCTTCACAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-1313s21c1
Sequence:CCGGTTTGGTGCTGACGCAGACTTCCTCGAGGAAGTCTGCGTCAGCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015944.2-252s1c1
Sequence:CCGGCGGTGGATTTGGTGTTGACTTCTCGAGAAGTCAACACCAAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015944.2-240s1c1
Sequence:CCGGCGTGCAGATCAACGGTGGATTCTCGAGAATCCACCGTTGATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-72s1c1
Sequence:CCGGCCAGTTCACTAACTGCCGGATCTCGAGATCCGGCAGTTAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-379s1c1
Sequence:CCGGGAGGTTTATCACAAGGTTGTTCTCGAGAACAACCTTGTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-814s1c1
Sequence:CCGGTGCATCTTCTATGGGATGATTCTCGAGAATCATCCCATAGAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015944
VALIDATED
AMDHD2 MISSION shRNA Lentiviral Transduction Particles
amidohydrolase domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-1356s21c1
Sequence:CCGGACGTCCAGGCCACCTACATCTCTCGAGAGATGTAGGTGGCCTGGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-470s21c1
Sequence:CCGGATCCCTGTGAAGAGTGGTGGTCTCGAGACCACCACTCTTCACAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015944.3-1313s21c1
Sequence:CCGGTTTGGTGCTGACGCAGACTTCCTCGAGGAAGTCTGCGTCAGCACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015944.2-252s1c1
Sequence:CCGGCGGTGGATTTGGTGTTGACTTCTCGAGAAGTCAACACCAAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015944.2-240s1c1
Sequence:CCGGCGTGCAGATCAACGGTGGATTCTCGAGAATCCACCGTTGATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-72s1c1
Sequence:CCGGCCAGTTCACTAACTGCCGGATCTCGAGATCCGGCAGTTAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-379s1c1
Sequence:CCGGGAGGTTTATCACAAGGTTGTTCTCGAGAACAACCTTGTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015944.2-814s1c1
Sequence:CCGGTGCATCTTCTATGGGATGATTCTCGAGAATCATCCCATAGAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172935
VALIDATED
AMDHD2 MISSION shRNA Bacterial Glycerol Stock
amidohydrolase domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-451s1c1
Sequence:CCGGGAGGTTTATCACAAGGTCCTTCTCGAGAAGGACCTTGTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-1051s1c1
Sequence:CCGGGATGGGCTAATAGCGTACATTCTCGAGAATGTACGCTATTAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-313s1c1
Sequence:CCGGGTGCAGATCAACGGTGGATTTCTCGAGAAATCCACCGTTGATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-1282s1c1
Sequence:CCGGGCCACTTACATCTCTGGTGAACTCGAGTTCACCAGAGATGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-882s1c1
Sequence:CCGGCCACTGCATCTTCTATGGGATCTCGAGATCCCATAGAAGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172935
VALIDATED
AMDHD2 MISSION shRNA shRNA Plasmid DNA
amidohydrolase domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-451s1c1
Sequence:CCGGGAGGTTTATCACAAGGTCCTTCTCGAGAAGGACCTTGTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-1051s1c1
Sequence:CCGGGATGGGCTAATAGCGTACATTCTCGAGAATGTACGCTATTAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-313s1c1
Sequence:CCGGGTGCAGATCAACGGTGGATTTCTCGAGAAATCCACCGTTGATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-1282s1c1
Sequence:CCGGGCCACTTACATCTCTGGTGAACTCGAGTTCACCAGAGATGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-882s1c1
Sequence:CCGGCCACTGCATCTTCTATGGGATCTCGAGATCCCATAGAAGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172935
VALIDATED
AMDHD2 MISSION shRNA Lentiviral Transduction Particles
amidohydrolase domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-451s1c1
Sequence:CCGGGAGGTTTATCACAAGGTCCTTCTCGAGAAGGACCTTGTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-1051s1c1
Sequence:CCGGGATGGGCTAATAGCGTACATTCTCGAGAATGTACGCTATTAGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-313s1c1
Sequence:CCGGGTGCAGATCAACGGTGGATTTCTCGAGAAATCCACCGTTGATCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-1282s1c1
Sequence:CCGGGCCACTTACATCTCTGGTGAACTCGAGTTCACCAGAGATGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172935.2-882s1c1
Sequence:CCGGCCACTGCATCTTCTATGGGATCTCGAGATCCCATAGAAGATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks