EMAIL THIS PAGE TO A FRIEND

AMELX

amelogenin, X-linked

85 Gene Product Result for
Synonyms: AI1E AIH1 ALGN AMG AMGL AMGX
UniProtKB ID: Q99217, Q96NW6, Q9UCA7
Gene ID:
Human(265) Summary: This gene encodes a member of the amelogenin family of extracellular matrix proteins. Amelogenins are involved in biomineralization during tooth enamel development. Mutations in this gene cause X-linked amelogenesis imperfecta. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(11704) amelogenin, X-linked
Rat(29160) amelogenin, X-linked
domestic cat(101085693) amelogenin, X-linked
dog(100683823) amelogenin, X-linked
Horse(100049799) amelogenin, X-linked
cow(281620) amelogenin, X-linked
domestic guinea pig(100379562) amelogenin X chromosome
sheep(101118759) amelogenin, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116451 MISSION® esiRNA esiRNA human AMELX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001142 Rosetta Predictions human pricing
NM_182680 Rosetta Predictions human pricing
NM_182681 Rosetta Predictions human pricing
NM_019154 Rosetta Predictions rat pricing
NM_001081978 Rosetta Predictions mouse pricing
NM_009666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175724 predicted 369
2 SASI_Hs01_00175725 predicted 570
3 SASI_Hs01_00175726 predicted 377
4 SASI_Hs01_00175727 predicted 378
5 SASI_Hs01_00175728 predicted 362
6 SASI_Hs01_00175729 predicted 377
7 SASI_Hs01_00175730 predicted 749
8 SASI_Hs01_00175733 predicted 673
9 SASI_Hs01_00175731 predicted 674
10 SASI_Hs01_00175732 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085023 predicted 791
2 SASI_Hs01_00085024 predicted 180
3 SASI_Hs01_00085025 predicted 154
4 SASI_Hs01_00085026 predicted 165
5 SASI_Hs01_00085027 predicted 613
6 SASI_Hs01_00085029 predicted 422
7 SASI_Hs01_00085030 predicted 160
8 SASI_Hs01_00085031 predicted 159
9 SASI_Hs02_00370848 predicted 712
10 SASI_Hs01_00085028 predicted 718
11 SASI_Hs01_00085032 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125326 predicted 700
2 SASI_Hs01_00125327 predicted 522
3 SASI_Hs01_00125328 predicted 156
4 SASI_Hs01_00125330 predicted 329
5 SASI_Hs01_00125332 predicted 635
6 SASI_Hs01_00125333 predicted 627
7 SASI_Hs01_00125329 predicted 626
8 SASI_Hs01_00125331 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065380 predicted 200
2 SASI_Rn01_00065381 predicted 380
3 SASI_Rn01_00065382 predicted 386
4 SASI_Rn01_00065383 predicted 193
5 SASI_Rn01_00065384 predicted 230
6 SASI_Rn01_00065385 predicted 197
7 SASI_Rn01_00065386 predicted 200
8 SASI_Rn01_00065387 predicted 278
9 SASI_Rn01_00065388 predicted 299
10 SASI_Rn01_00065389 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299172 predicted 203
2 SASI_Mm02_00299173 predicted 383
3 SASI_Mm02_00299174 predicted 401
4 SASI_Mm02_00299175 predicted 207
5 SASI_Mm02_00299176 predicted 207
6 SASI_Mm02_00299177 predicted 208
7 SASI_Mm02_00299178 predicted 203
8 SASI_Mm02_00299179 predicted 304
9 SASI_Mm02_00299180 predicted 388
10 SASI_Mm02_00299181 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073228 predicted 210
2 SASI_Mm01_00073229 predicted 389
3 SASI_Mm01_00073230 predicted 401
4 SASI_Mm01_00073231 predicted 211
5 SASI_Mm01_00073232 predicted 212
6 SASI_Mm01_00073233 predicted 212
7 SASI_Mm02_00316691 predicted 207
8 SASI_Mm01_00073235 predicted 303
9 SASI_Mm01_00073236 predicted 391
10 SASI_Mm01_00073237 predicted 374
11 SASI_Mm01_00073234 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142
AMELX MISSION shRNA Bacterial Glycerol Stock
amelogenin, X-linked
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-194s1c1
Sequence:CCGGCCAGAGCATAAGGCCACCGTACTCGAGTACGGTGGCCTTATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-386s1c1
Sequence:CCGGACACTCCATGACTCCAATCCACTCGAGTGGATTGGAGTCATGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-140s1c1
Sequence:CCGGGCACCCTGGTTATATCAACTTCTCGAGAAGTTGATATAACCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-573s1c1
Sequence:CCGGCCCATGCTTCCTGATCTGACTCTCGAGAGTCAGATCAGGAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-356s1c1
Sequence:CCGGCCAGCAACCAATGATGCCCGTCTCGAGACGGGCATCATTGGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142.2-601s21c1
Sequence:CCGGCTTGGCCATCAACAGACAAGACTCGAGTCTTGTCTGTTGATGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142.2-242s21c1
Sequence:CCGGTGGATGGCTGCACCACCAAATCTCGAGATTTGGTGGTGCAGCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142
AMELX MISSION shRNA shRNA Plasmid DNA
amelogenin, X-linked
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-194s1c1
Sequence:CCGGCCAGAGCATAAGGCCACCGTACTCGAGTACGGTGGCCTTATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-386s1c1
Sequence:CCGGACACTCCATGACTCCAATCCACTCGAGTGGATTGGAGTCATGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-140s1c1
Sequence:CCGGGCACCCTGGTTATATCAACTTCTCGAGAAGTTGATATAACCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-573s1c1
Sequence:CCGGCCCATGCTTCCTGATCTGACTCTCGAGAGTCAGATCAGGAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-356s1c1
Sequence:CCGGCCAGCAACCAATGATGCCCGTCTCGAGACGGGCATCATTGGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142.2-601s21c1
Sequence:CCGGCTTGGCCATCAACAGACAAGACTCGAGTCTTGTCTGTTGATGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142.2-242s21c1
Sequence:CCGGTGGATGGCTGCACCACCAAATCTCGAGATTTGGTGGTGCAGCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142
AMELX MISSION shRNA Lentiviral Transduction Particles
amelogenin, X-linked
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-194s1c1
Sequence:CCGGCCAGAGCATAAGGCCACCGTACTCGAGTACGGTGGCCTTATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-386s1c1
Sequence:CCGGACACTCCATGACTCCAATCCACTCGAGTGGATTGGAGTCATGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-140s1c1
Sequence:CCGGGCACCCTGGTTATATCAACTTCTCGAGAAGTTGATATAACCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-573s1c1
Sequence:CCGGCCCATGCTTCCTGATCTGACTCTCGAGAGTCAGATCAGGAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001142.2-356s1c1
Sequence:CCGGCCAGCAACCAATGATGCCCGTCTCGAGACGGGCATCATTGGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142.2-601s21c1
Sequence:CCGGCTTGGCCATCAACAGACAAGACTCGAGTCTTGTCTGTTGATGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142.2-242s21c1
Sequence:CCGGTGGATGGCTGCACCACCAAATCTCGAGATTTGGTGGTGCAGCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009666
AMELX MISSION shRNA Bacterial Glycerol Stock
amelogenin, X-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-146s1c1
Sequence:CCGGGCCCTGGTTATATCAACTTAACTCGAGTTAAGTTGATATAACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-216s1c1
Sequence:CCGGGCCGTATCCTTCCTATGGTTACTCGAGTAACCATAGGAAGGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-410s1c1
Sequence:CCGGCCCAACACCATCAGCCAAACACTCGAGTGTTTGGCTGATGGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-631s1c1
Sequence:CCGGACAGACAAGACCAAGCGGGAACTCGAGTTCCCGCTTGGTCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-202s1c1
Sequence:CCGGAGCATGATAAGGCAGCCGTATCTCGAGATACGGCTGCCTTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009666
AMELX MISSION shRNA shRNA Plasmid DNA
amelogenin, X-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-146s1c1
Sequence:CCGGGCCCTGGTTATATCAACTTAACTCGAGTTAAGTTGATATAACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-216s1c1
Sequence:CCGGGCCGTATCCTTCCTATGGTTACTCGAGTAACCATAGGAAGGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-410s1c1
Sequence:CCGGCCCAACACCATCAGCCAAACACTCGAGTGTTTGGCTGATGGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-631s1c1
Sequence:CCGGACAGACAAGACCAAGCGGGAACTCGAGTTCCCGCTTGGTCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-202s1c1
Sequence:CCGGAGCATGATAAGGCAGCCGTATCTCGAGATACGGCTGCCTTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009666
AMELX MISSION shRNA Lentiviral Transduction Particles
amelogenin, X-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-146s1c1
Sequence:CCGGGCCCTGGTTATATCAACTTAACTCGAGTTAAGTTGATATAACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-216s1c1
Sequence:CCGGGCCGTATCCTTCCTATGGTTACTCGAGTAACCATAGGAAGGATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-410s1c1
Sequence:CCGGCCCAACACCATCAGCCAAACACTCGAGTGTTTGGCTGATGGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-631s1c1
Sequence:CCGGACAGACAAGACCAAGCGGGAACTCGAGTTCCCGCTTGGTCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009666.1-202s1c1
Sequence:CCGGAGCATGATAAGGCAGCCGTATCTCGAGATACGGCTGCCTTATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks