EMAIL THIS PAGE TO A FRIEND

AMELY

amelogenin, Y-linked

31 Gene Product Result for
Synonyms: AMGL AMGY
UniProtKB ID: Q99218, Q6RWT1
Gene ID:
Human(266) Summary: This gene encodes a member of the amelogenin family of extracellular matrix proteins. Amelogenins are involved in biomineralization during tooth enamel development. Mutations in a related gene on chromosome X cause X-linked amelogenesis imperfecta. [provided by RefSeq, Jul 2008]
sheep(448815) amelogenin, Y-linked
cow(281621) amelogenin, Y-linked
Horse(100034231) amelogenin, Y-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127731 MISSION® esiRNA esiRNA human AMELY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001143 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126514 predicted 573
2 SASI_Hs01_00126515 predicted 208
3 SASI_Hs01_00126516 predicted 396
4 SASI_Hs01_00126517 predicted 355
5 SASI_Hs01_00126518 predicted 290
6 SASI_Hs01_00126519 predicted 209
7 SASI_Hs01_00126520 predicted 384
8 SASI_Hs01_00126521 predicted 657
9 SASI_Hs01_00126522 predicted 757
10 SASI_Hs01_00126523 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143
AMELY MISSION shRNA Bacterial Glycerol Stock
amelogenin, Y-linked
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-191s21c1
Sequence:CCGGGTACCAGAGCATGATAAGACCCTCGAGGGTCTTATCATGCTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-577s21c1
Sequence:CCGGCCATACTTCCTGATCTGCATCCTCGAGGATGCAGATCAGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-202s21c1
Sequence:CCGGTGATAAGACCACCATACTCTTCTCGAGAAGAGTATGGTGGTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-360s21c1
Sequence:CCGGCAGCAAGCACTGATGCCTGTTCTCGAGAACAGGCATCAGTGCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-377s21c1
Sequence:CCGGTGTTCCTGGCCAGCAATCCATCTCGAGATGGATTGCTGGCCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001143.1-576s1c1
Sequence:CCGGCCCATACTTCCTGATCTGCATCTCGAGATGCAGATCAGGAAGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001143.1-197s1c1
Sequence:CCGGGAGCATGATAAGACCACCATACTCGAGTATGGTGGTCTTATCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143
AMELY MISSION shRNA shRNA Plasmid DNA
amelogenin, Y-linked
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-191s21c1
Sequence:CCGGGTACCAGAGCATGATAAGACCCTCGAGGGTCTTATCATGCTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-577s21c1
Sequence:CCGGCCATACTTCCTGATCTGCATCCTCGAGGATGCAGATCAGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-202s21c1
Sequence:CCGGTGATAAGACCACCATACTCTTCTCGAGAAGAGTATGGTGGTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-360s21c1
Sequence:CCGGCAGCAAGCACTGATGCCTGTTCTCGAGAACAGGCATCAGTGCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-377s21c1
Sequence:CCGGTGTTCCTGGCCAGCAATCCATCTCGAGATGGATTGCTGGCCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001143.1-576s1c1
Sequence:CCGGCCCATACTTCCTGATCTGCATCTCGAGATGCAGATCAGGAAGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001143.1-197s1c1
Sequence:CCGGGAGCATGATAAGACCACCATACTCGAGTATGGTGGTCTTATCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143
AMELY MISSION shRNA Lentiviral Transduction Particles
amelogenin, Y-linked
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-191s21c1
Sequence:CCGGGTACCAGAGCATGATAAGACCCTCGAGGGTCTTATCATGCTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-577s21c1
Sequence:CCGGCCATACTTCCTGATCTGCATCCTCGAGGATGCAGATCAGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-202s21c1
Sequence:CCGGTGATAAGACCACCATACTCTTCTCGAGAAGAGTATGGTGGTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-360s21c1
Sequence:CCGGCAGCAAGCACTGATGCCTGTTCTCGAGAACAGGCATCAGTGCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143.1-377s21c1
Sequence:CCGGTGTTCCTGGCCAGCAATCCATCTCGAGATGGATTGCTGGCCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001143.1-576s1c1
Sequence:CCGGCCCATACTTCCTGATCTGCATCTCGAGATGCAGATCAGGAAGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001143.1-197s1c1
Sequence:CCGGGAGCATGATAAGACCACCATACTCGAGTATGGTGGTCTTATCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks