EMAIL THIS PAGE TO A FRIEND

AMER1

APC membrane recruitment protein 1

329 Gene Product Result for
Synonyms: FAM123B OSCS WTX
UniProtKB ID: Q5JTC6, A2IB86, Q8N885
Gene ID:
Human(139285) Summary: The protein encoded by this gene upregulates trancriptional activation by the Wilms tumor protein and interacts with many other proteins, including CTNNB1, APC, AXIN1, and AXIN2. Defects in this gene are a cause of osteopathia striata with cranial sclerosis (OSCS). [provided by RefSeq, May 2010]
Mouse(72345) APC membrane recruitment 1
Rat(501584) APC membrane recruitment protein 1
Zebrafish(100885784) APC membrane recruitment protein 1
domestic guinea pig(100732722) APC membrane recruitment protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062531 MISSION® esiRNA esiRNA targeting mouse Fam123b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152424 Rosetta Predictions human pricing
NM_001109320 Rosetta Predictions rat pricing
NM_175179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102265 predicted 2272
2 SASI_Hs01_00102266 predicted 375
3 SASI_Hs02_00366158 predicted 3258
4 SASI_Hs01_00102267 predicted 2064
5 SASI_Hs02_00366159 predicted 3255
6 SASI_Hs01_00102269 predicted 1828
7 SASI_Hs02_00366160 predicted 2746
8 SASI_Hs02_00366161 predicted 643
9 SASI_Hs02_00366162 predicted 3409
10 SASI_Hs01_00102272 predicted 633
11 SASI_Hs01_00102268 predicted 591
12 SASI_Hs01_00102270 predicted 469
13 SASI_Hs01_00102271 predicted 751
14 SASI_Hs01_00102273 predicted 737
15 SASI_Hs01_00102274 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247264 predicted 1852
2 SASI_Rn02_00247265 predicted 422
3 SASI_Rn02_00247266 predicted 1717
4 SASI_Rn02_00247267 predicted 1063
5 SASI_Rn02_00247268 predicted 930
6 SASI_Rn02_00247269 predicted 3007
7 SASI_Rn02_00247270 predicted 2088
8 SASI_Rn02_00247271 predicted 1567
9 SASI_Rn02_00247272 predicted 837
10 SASI_Rn02_00247273 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345821 predicted 1856
2 SASI_Mm02_00345822 predicted 3656
3 SASI_Mm02_00345823 predicted 3210
4 SASI_Mm01_00049964 predicted 872
5 SASI_Mm02_00345824 predicted 1720
6 SASI_Mm02_00345825 predicted 3471
7 SASI_Mm01_00049965 predicted 508
8 SASI_Mm02_00345826 predicted 2756
9 SASI_Mm02_00345827 predicted 1824
10 SASI_Mm02_00345828 predicted 2643
11 SASI_Mm01_00049960 predicted 624
12 SASI_Mm01_00049961 predicted 603
13 SASI_Mm01_00049962 predicted 578
14 SASI_Mm01_00049963 predicted 535
15 SASI_Mm01_00049966 predicted 905
16 SASI_Mm01_00049967 predicted 913
17 SASI_Mm01_00049968 predicted 346
18 SASI_Mm01_00049969 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152424
AMER1 MISSION shRNA Bacterial Glycerol Stock
APC membrane recruitment protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-1780s1c1
Sequence:CCGGGATGCCCTATATGAGTTCTATCTCGAGATAGAACTCATATAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-2399s1c1
Sequence:CCGGGCTCCAAGAAAGATCAAAGTACTCGAGTACTTTGATCTTTCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-3026s1c1
Sequence:CCGGGCTCAGTTGATTGTGACATTTCTCGAGAAATGTCACAATCAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-1666s1c1
Sequence:CCGGCCCAATAGTGATGAAGGTTATCTCGAGATAACCTTCATCACTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-1667s1c1
Sequence:CCGGCCAATAGTGATGAAGGTTATTCTCGAGAATAACCTTCATCACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-2396s1c1
Sequence:CCGGCCTGCTCCAAGAAAGATCAAACTCGAGTTTGATCTTTCTTGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152424.1-3207s1c1
Sequence:CCGGCCCTGACTTTCCAATCCTATACTCGAGTATAGGATTGGAAAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-2590s1c1
Sequence:CCGGCTGGTAGAGTTCACCAGCAATCTCGAGATTGCTGGTGAACTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-332s1c1
Sequence:CCGGCCCGTGAACAAACAGCAGAAACTCGAGTTTCTGCTGTTTGTTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152424
AMER1 MISSION shRNA shRNA Plasmid DNA
APC membrane recruitment protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-1780s1c1
Sequence:CCGGGATGCCCTATATGAGTTCTATCTCGAGATAGAACTCATATAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-2399s1c1
Sequence:CCGGGCTCCAAGAAAGATCAAAGTACTCGAGTACTTTGATCTTTCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-3026s1c1
Sequence:CCGGGCTCAGTTGATTGTGACATTTCTCGAGAAATGTCACAATCAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-1666s1c1
Sequence:CCGGCCCAATAGTGATGAAGGTTATCTCGAGATAACCTTCATCACTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-1667s1c1
Sequence:CCGGCCAATAGTGATGAAGGTTATTCTCGAGAATAACCTTCATCACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-2396s1c1
Sequence:CCGGCCTGCTCCAAGAAAGATCAAACTCGAGTTTGATCTTTCTTGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152424.1-3207s1c1
Sequence:CCGGCCCTGACTTTCCAATCCTATACTCGAGTATAGGATTGGAAAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-2590s1c1
Sequence:CCGGCTGGTAGAGTTCACCAGCAATCTCGAGATTGCTGGTGAACTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-332s1c1
Sequence:CCGGCCCGTGAACAAACAGCAGAAACTCGAGTTTCTGCTGTTTGTTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152424
AMER1 MISSION shRNA Lentiviral Transduction Particles
APC membrane recruitment protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-1780s1c1
Sequence:CCGGGATGCCCTATATGAGTTCTATCTCGAGATAGAACTCATATAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-2399s1c1
Sequence:CCGGGCTCCAAGAAAGATCAAAGTACTCGAGTACTTTGATCTTTCTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-3026s1c1
Sequence:CCGGGCTCAGTTGATTGTGACATTTCTCGAGAAATGTCACAATCAACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-1666s1c1
Sequence:CCGGCCCAATAGTGATGAAGGTTATCTCGAGATAACCTTCATCACTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-1667s1c1
Sequence:CCGGCCAATAGTGATGAAGGTTATTCTCGAGAATAACCTTCATCACTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-2396s1c1
Sequence:CCGGCCTGCTCCAAGAAAGATCAAACTCGAGTTTGATCTTTCTTGGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152424.1-3207s1c1
Sequence:CCGGCCCTGACTTTCCAATCCTATACTCGAGTATAGGATTGGAAAGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152424.1-2590s1c1
Sequence:CCGGCTGGTAGAGTTCACCAGCAATCTCGAGATTGCTGGTGAACTCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152424.1-332s1c1
Sequence:CCGGCCCGTGAACAAACAGCAGAAACTCGAGTTTCTGCTGTTTGTTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175179
AMER1 MISSION shRNA Bacterial Glycerol Stock
APC membrane recruitment protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1215s1c1
Sequence:CCGGGCTTTGACTCACTGACAGGTTCTCGAGAACCTGTCAGTGAGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1172s1c1
Sequence:CCGGGATCAGCTAAGCCTCTTGTTTCTCGAGAAACAAGAGGCTTAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1228s1c1
Sequence:CCGGGACAGGTTGTGGTGACATTATCTCGAGATAATGTCACCACAACCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175179.2-288s1c1
Sequence:CCGGCCAAAGGAGCATCAACTTCTACTCGAGTAGAAGTTGATGCTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175179.2-450s1c1
Sequence:CCGGGAATCTGTACTCTGCCTAGTTCTCGAGAACTAGGCAGAGTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175179.4-3654s21c1
Sequence:CCGGGAAACCTAGCCAAGTAGTTATCTCGAGATAACTACTTGGCTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175179.4-1726s21c1
Sequence:CCGGCAATAGTGATGAAGGTTATTACTCGAGTAATAACCTTCATCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175179
AMER1 MISSION shRNA shRNA Plasmid DNA
APC membrane recruitment protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1215s1c1
Sequence:CCGGGCTTTGACTCACTGACAGGTTCTCGAGAACCTGTCAGTGAGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1172s1c1
Sequence:CCGGGATCAGCTAAGCCTCTTGTTTCTCGAGAAACAAGAGGCTTAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1228s1c1
Sequence:CCGGGACAGGTTGTGGTGACATTATCTCGAGATAATGTCACCACAACCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175179.2-288s1c1
Sequence:CCGGCCAAAGGAGCATCAACTTCTACTCGAGTAGAAGTTGATGCTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175179.2-450s1c1
Sequence:CCGGGAATCTGTACTCTGCCTAGTTCTCGAGAACTAGGCAGAGTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175179.4-3654s21c1
Sequence:CCGGGAAACCTAGCCAAGTAGTTATCTCGAGATAACTACTTGGCTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175179.4-1726s21c1
Sequence:CCGGCAATAGTGATGAAGGTTATTACTCGAGTAATAACCTTCATCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175179
AMER1 MISSION shRNA Lentiviral Transduction Particles
APC membrane recruitment protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1215s1c1
Sequence:CCGGGCTTTGACTCACTGACAGGTTCTCGAGAACCTGTCAGTGAGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1172s1c1
Sequence:CCGGGATCAGCTAAGCCTCTTGTTTCTCGAGAAACAAGAGGCTTAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175179.2-1228s1c1
Sequence:CCGGGACAGGTTGTGGTGACATTATCTCGAGATAATGTCACCACAACCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175179.2-288s1c1
Sequence:CCGGCCAAAGGAGCATCAACTTCTACTCGAGTAGAAGTTGATGCTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175179.2-450s1c1
Sequence:CCGGGAATCTGTACTCTGCCTAGTTCTCGAGAACTAGGCAGAGTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175179.4-3654s21c1
Sequence:CCGGGAAACCTAGCCAAGTAGTTATCTCGAGATAACTACTTGGCTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175179.4-1726s21c1
Sequence:CCGGCAATAGTGATGAAGGTTATTACTCGAGTAATAACCTTCATCACTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks