EMAIL THIS PAGE TO A FRIEND

AMER2

APC membrane recruitment protein 2

249 Gene Product Result for
Synonyms: FAM123A
UniProtKB ID: Q8N7J2, Q5RL80, Q5VX56, Q8N593, Q96NN5
Gene ID:
Mouse(72125) APC membrane recruitment 2
Rat(498529) APC membrane recruitment protein 2
naked mole-rat(101723741) APC membrane recruitment protein 2
domestic guinea pig(100729012) APC membrane recruitment protein 2
Zebrafish(100101649) APC membrane recruitment protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035651 MISSION® esiRNA esiRNA targeting mouse Fam123a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152704 Rosetta Predictions human pricing
NM_199138 Rosetta Predictions human pricing
XM_001063071 Rosetta Predictions rat pricing
XM_573799 Rosetta Predictions rat pricing
NM_028113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011748 predicted 1892
2 SASI_Hs01_00011749 predicted 1566
3 SASI_Hs01_00011750 predicted 1914
4 SASI_Hs01_00011751 predicted 1912
5 SASI_Hs01_00011752 predicted 1942
6 SASI_Hs01_00011753 predicted 1922
7 SASI_Hs01_00011754 predicted 1758
8 SASI_Hs01_00011755 predicted 1901
9 SASI_Hs01_00011756 predicted 211
10 SASI_Hs01_00011757 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243020 predicted 1535
2 SASI_Hs01_00243021 predicted 1209
3 SASI_Hs01_00243022 predicted 1555
4 SASI_Hs01_00243023 predicted 1553
5 SASI_Hs01_00243024 predicted 1583
6 SASI_Hs01_00243025 predicted 1565
7 SASI_Hs01_00243026 predicted 1401
8 SASI_Hs01_00243027 predicted 1543
9 SASI_Hs01_00243028 predicted 217
10 SASI_Hs01_00243029 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305678 predicted 1424
2 SASI_Rn02_00305679 predicted 1667
3 SASI_Rn02_00305680 predicted 2494
4 SASI_Rn02_00305681 predicted 2510
5 SASI_Rn02_00305682 predicted 1903
6 SASI_Rn02_00305683 predicted 1600
7 SASI_Rn02_00305684 predicted 2267
8 SASI_Rn02_00305685 predicted 2234
9 SASI_Rn02_00305686 predicted 2290
10 SASI_Rn02_00305687 predicted 2113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400830 predicted 2201
2 SASI_Rn02_00400831 predicted 2450
3 SASI_Rn02_00400832 predicted 3275
4 SASI_Rn02_00400833 predicted 3279
5 SASI_Rn02_00400834 predicted 2685
6 SASI_Rn02_00400835 predicted 2377
7 SASI_Rn02_00400836 predicted 3036
8 SASI_Rn02_00400837 predicted 3014
9 SASI_Rn02_00400838 predicted 3061
10 SASI_Rn02_00400839 predicted 2888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044556 predicted 1938
2 SASI_Mm01_00044557 predicted 1571
3 SASI_Mm02_00333362 predicted 1938
4 SASI_Mm01_00044559 predicted 1039
5 SASI_Mm01_00044560 predicted 1882
6 SASI_Mm02_00333363 predicted 1699
7 SASI_Mm01_00044561 predicted 1728
8 SASI_Mm01_00044562 predicted 1252
9 SASI_Mm01_00044563 predicted 1678
10 SASI_Mm01_00044565 predicted 1237
11 SASI_Mm01_00044558 predicted 1947
12 SASI_Mm01_00044564 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199138
AMER2 MISSION shRNA Bacterial Glycerol Stock
APC membrane recruitment protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199138.1-1977s21c1
Sequence:CCGGGATAAGTCCCTGAGAATTATTCTCGAGAATAATTCTCAGGGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199138.1-2116s21c1
Sequence:CCGGTAAGAGTCATGCCTGGATATTCTCGAGAATATCCAGGCATGACTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199138.1-291s21c1
Sequence:CCGGATAAAGCTGCCTTCAAATTATCTCGAGATAATTTGAAGGCAGCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-283s1c1
Sequence:CCGGGAAGATTAATAAAGCTGCCTTCTCGAGAAGGCAGCTTTATTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1567s1c1
Sequence:CCGGCCCTATTAGCATCAAGCACCTCTCGAGAGGTGCTTGATGCTAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1039s1c1
Sequence:CCGGCGACACCTATCTACAGGAGTTCTCGAGAACTCCTGTAGATAGGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-876s1c1
Sequence:CCGGCAGCAGGCTGTGGAGATATTACTCGAGTAATATCTCCACAGCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1552s1c1
Sequence:CCGGGAAGGACTCTAAGATCCCTATCTCGAGATAGGGATCTTAGAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-878s1c1
Sequence:CCGGGCAGGCTGTGGAGATATTATTCTCGAGAATAATATCTCCACAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199138.1-1810s1c1
Sequence:CCGGCCCTGGAAACCACTAAAGTAACTCGAGTTACTTTAGTGGTTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199138
AMER2 MISSION shRNA shRNA Plasmid DNA
APC membrane recruitment protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199138.1-1977s21c1
Sequence:CCGGGATAAGTCCCTGAGAATTATTCTCGAGAATAATTCTCAGGGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199138.1-2116s21c1
Sequence:CCGGTAAGAGTCATGCCTGGATATTCTCGAGAATATCCAGGCATGACTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199138.1-291s21c1
Sequence:CCGGATAAAGCTGCCTTCAAATTATCTCGAGATAATTTGAAGGCAGCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-283s1c1
Sequence:CCGGGAAGATTAATAAAGCTGCCTTCTCGAGAAGGCAGCTTTATTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1567s1c1
Sequence:CCGGCCCTATTAGCATCAAGCACCTCTCGAGAGGTGCTTGATGCTAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1039s1c1
Sequence:CCGGCGACACCTATCTACAGGAGTTCTCGAGAACTCCTGTAGATAGGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-876s1c1
Sequence:CCGGCAGCAGGCTGTGGAGATATTACTCGAGTAATATCTCCACAGCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1552s1c1
Sequence:CCGGGAAGGACTCTAAGATCCCTATCTCGAGATAGGGATCTTAGAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-878s1c1
Sequence:CCGGGCAGGCTGTGGAGATATTATTCTCGAGAATAATATCTCCACAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199138.1-1810s1c1
Sequence:CCGGCCCTGGAAACCACTAAAGTAACTCGAGTTACTTTAGTGGTTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199138
AMER2 MISSION shRNA Lentiviral Transduction Particles
APC membrane recruitment protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199138.1-1977s21c1
Sequence:CCGGGATAAGTCCCTGAGAATTATTCTCGAGAATAATTCTCAGGGACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199138.1-2116s21c1
Sequence:CCGGTAAGAGTCATGCCTGGATATTCTCGAGAATATCCAGGCATGACTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199138.1-291s21c1
Sequence:CCGGATAAAGCTGCCTTCAAATTATCTCGAGATAATTTGAAGGCAGCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-283s1c1
Sequence:CCGGGAAGATTAATAAAGCTGCCTTCTCGAGAAGGCAGCTTTATTAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1567s1c1
Sequence:CCGGCCCTATTAGCATCAAGCACCTCTCGAGAGGTGCTTGATGCTAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1039s1c1
Sequence:CCGGCGACACCTATCTACAGGAGTTCTCGAGAACTCCTGTAGATAGGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-876s1c1
Sequence:CCGGCAGCAGGCTGTGGAGATATTACTCGAGTAATATCTCCACAGCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-1552s1c1
Sequence:CCGGGAAGGACTCTAAGATCCCTATCTCGAGATAGGGATCTTAGAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199138.1-878s1c1
Sequence:CCGGGCAGGCTGTGGAGATATTATTCTCGAGAATAATATCTCCACAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199138.1-1810s1c1
Sequence:CCGGCCCTGGAAACCACTAAAGTAACTCGAGTTACTTTAGTGGTTTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028113
AMER2 MISSION shRNA Bacterial Glycerol Stock
APC membrane recruitment protein 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000192730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-1052s1c1
Sequence:CCGGGATATTATTGCAGACCCAGAACTCGAGTTCTGGGTCTGCAATAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-1448s1c1
Sequence:CCGGGAAGGTGTTCCTAACAGCGATCTCGAGATCGCTGTTAGGAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-70s1c1
Sequence:CCGGGAAGATCAATAAGGCTGCGTTCTCGAGAACGCAGCCTTATTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028113.1-1950s1c1
Sequence:CCGGGCCATATGTTAAGGAATACAACTCGAGTTGTATTCCTTAACATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028113
AMER2 MISSION shRNA shRNA Plasmid DNA
APC membrane recruitment protein 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000192730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-1052s1c1
Sequence:CCGGGATATTATTGCAGACCCAGAACTCGAGTTCTGGGTCTGCAATAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-1448s1c1
Sequence:CCGGGAAGGTGTTCCTAACAGCGATCTCGAGATCGCTGTTAGGAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-70s1c1
Sequence:CCGGGAAGATCAATAAGGCTGCGTTCTCGAGAACGCAGCCTTATTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028113.1-1950s1c1
Sequence:CCGGGCCATATGTTAAGGAATACAACTCGAGTTGTATTCCTTAACATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028113
AMER2 MISSION shRNA Lentiviral Transduction Particles
APC membrane recruitment protein 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000192730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-1052s1c1
Sequence:CCGGGATATTATTGCAGACCCAGAACTCGAGTTCTGGGTCTGCAATAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-1448s1c1
Sequence:CCGGGAAGGTGTTCCTAACAGCGATCTCGAGATCGCTGTTAGGAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028113.1-70s1c1
Sequence:CCGGGAAGATCAATAAGGCTGCGTTCTCGAGAACGCAGCCTTATTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028113.1-1950s1c1
Sequence:CCGGGCCATATGTTAAGGAATACAACTCGAGTTGTATTCCTTAACATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks