EMAIL THIS PAGE TO A FRIEND

AMER3

APC membrane recruitment protein 3

84 Gene Product Result for
Synonyms: FAM123C
UniProtKB ID: Q8N944, B7ZLH6
Gene ID:
Mouse(211383) APC membrane recruitment 3
Rat(501122) APC membrane recruitment protein 3
chicken(100859787) APC membrane recruitment protein 3
domestic guinea pig(101788236) APC membrane recruitment protein 3
naked mole-rat(101710850) APC membrane recruitment protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152698 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_213727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_213727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_213727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105193 Rosetta Predictions human pricing
NM_001105194 Rosetta Predictions human pricing
NM_001105195 Rosetta Predictions human pricing
NM_152698 Rosetta Predictions human pricing
XM_001055491 Rosetta Predictions rat pricing
XM_576539 Rosetta Predictions rat pricing
NM_213727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323904 predicted 639
2 SASI_Hs02_00323905 predicted 2814
3 SASI_Hs02_00323906 predicted 2155
4 SASI_Hs02_00323907 predicted 1485
5 SASI_Hs02_00323908 predicted 2783
6 SASI_Hs02_00323909 predicted 1315
7 SASI_Hs02_00323910 predicted 1659
8 SASI_Hs02_00323911 predicted 2035
9 SASI_Hs02_00323912 predicted 1490
10 SASI_Hs02_00323913 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323914 predicted 574
2 SASI_Hs02_00323915 predicted 2752
3 SASI_Hs02_00323916 predicted 2093
4 SASI_Hs02_00323917 predicted 1419
5 SASI_Hs02_00323918 predicted 2716
6 SASI_Hs02_00323919 predicted 1255
7 SASI_Hs02_00323920 predicted 1596
8 SASI_Hs02_00323921 predicted 1969
9 SASI_Hs02_00323922 predicted 1427
10 SASI_Hs02_00323923 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323924 predicted 569
2 SASI_Hs02_00323925 predicted 2746
3 SASI_Hs02_00323926 predicted 2097
4 SASI_Hs02_00323927 predicted 1412
5 SASI_Hs02_00323928 predicted 2712
6 SASI_Hs02_00323929 predicted 1251
7 SASI_Hs02_00323930 predicted 1595
8 SASI_Hs02_00323931 predicted 1974
9 SASI_Hs02_00323932 predicted 1425
10 SASI_Hs02_00323933 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087270 predicted 655
2 SASI_Hs01_00087271 predicted 2832
3 SASI_Hs02_00366590 predicted 2180
4 SASI_Hs01_00087272 predicted 1495
5 SASI_Hs01_00087273 predicted 2796
6 SASI_Hs01_00087274 predicted 1332
7 SASI_Hs01_00087275 predicted 1673
8 SASI_Hs01_00087276 predicted 2048
9 SASI_Hs01_00087277 predicted 1508
10 SASI_Hs01_00087278 predicted 1325
11 SASI_Hs01_00087279 predicted 2590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279701 predicted 2482
2 SASI_Rn02_00279702 predicted 996
3 SASI_Rn02_00279703 predicted 2415
4 SASI_Rn02_00279704 predicted 2888
5 SASI_Rn02_00279705 predicted 1214
6 SASI_Rn02_00279706 predicted 1120
7 SASI_Rn02_00279707 predicted 1626
8 SASI_Rn02_00279708 predicted 2617
9 SASI_Rn02_00279709 predicted 2203
10 SASI_Rn02_00279710 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405499 predicted 315
2 SASI_Rn02_00405500 predicted 994
3 SASI_Rn02_00405501 predicted 204
4 SASI_Rn02_00405502 predicted 1087
5 SASI_Rn02_00405503 predicted 845
6 SASI_Rn02_00405504 predicted 892
7 SASI_Rn02_00405505 predicted 1070
8 SASI_Rn02_00405506 predicted 850
9 SASI_Rn02_00405507 predicted 1015
10 SASI_Rn02_00405508 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087307 predicted 317
2 SASI_Mm01_00087308 predicted 1057
3 SASI_Mm01_00087309 predicted 506
4 SASI_Mm01_00087310 predicted 2092
5 SASI_Mm01_00087311 predicted 411
6 SASI_Mm02_00352301 predicted 2239
7 SASI_Mm01_00087312 predicted 923
8 SASI_Mm01_00087313 predicted 294
9 SASI_Mm01_00087314 predicted 550
10 SASI_Mm02_00352302 predicted 2429
11 SASI_Mm01_00087315 predicted 2486
12 SASI_Mm01_00087316 predicted 1863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152698
AMER3 MISSION shRNA Bacterial Glycerol Stock
APC membrane recruitment protein 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-1980s1c1
Sequence:CCGGCTGAAGGCTTGTTCTCCTCTACTCGAGTAGAGGAGAACAAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2019s1c1
Sequence:CCGGCGACAACAGATACTTCCGGTACTCGAGTACCGGAAGTATCTGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-625s1c1
Sequence:CCGGGAAGTGCTTTCGGAACCTATTCTCGAGAATAGGTTCCGAAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-655s1c1
Sequence:CCGGGAGAAACAAGACTGAGGACTTCTCGAGAAGTCCTCAGTCTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152698.1-2796s1c1
Sequence:CCGGGCCTAGGACTCAAATCTCTATCTCGAGATAGAGATTTGAGTCCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2020s1c1
Sequence:CCGGGACAACAGATACTTCCGGTAACTCGAGTTACCGGAAGTATCTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-631s1c1
Sequence:CCGGCTTTCGGAACCTATTCCACATCTCGAGATGTGGAATAGGTTCCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2013s1c1
Sequence:CCGGCCACTTCGACAACAGATACTTCTCGAGAAGTATCTGTTGTCGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-640s1c1
Sequence:CCGGCCTATTCCACATTCGGAGAAACTCGAGTTTCTCCGAATGTGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2200s1c1
Sequence:CCGGCCTGAAGATCAGCTCAAACGACTCGAGTCGTTTGAGCTGATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-595s1c1
Sequence:CCGGGAGGAAGAGGATTTCCCTGAACTCGAGTTCAGGGAAATCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-327s1c1
Sequence:CCGGGTGCCCAAGAATACGACAGATCTCGAGATCTGTCGTATTCTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-1051s1c1
Sequence:CCGGCCAGAATGAAGCCTCTGACTTCTCGAGAAGTCAGAGGCTTCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152698
AMER3 MISSION shRNA shRNA Plasmid DNA
APC membrane recruitment protein 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-1980s1c1
Sequence:CCGGCTGAAGGCTTGTTCTCCTCTACTCGAGTAGAGGAGAACAAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2019s1c1
Sequence:CCGGCGACAACAGATACTTCCGGTACTCGAGTACCGGAAGTATCTGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-625s1c1
Sequence:CCGGGAAGTGCTTTCGGAACCTATTCTCGAGAATAGGTTCCGAAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-655s1c1
Sequence:CCGGGAGAAACAAGACTGAGGACTTCTCGAGAAGTCCTCAGTCTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152698.1-2796s1c1
Sequence:CCGGGCCTAGGACTCAAATCTCTATCTCGAGATAGAGATTTGAGTCCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2020s1c1
Sequence:CCGGGACAACAGATACTTCCGGTAACTCGAGTTACCGGAAGTATCTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-631s1c1
Sequence:CCGGCTTTCGGAACCTATTCCACATCTCGAGATGTGGAATAGGTTCCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2013s1c1
Sequence:CCGGCCACTTCGACAACAGATACTTCTCGAGAAGTATCTGTTGTCGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-640s1c1
Sequence:CCGGCCTATTCCACATTCGGAGAAACTCGAGTTTCTCCGAATGTGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2200s1c1
Sequence:CCGGCCTGAAGATCAGCTCAAACGACTCGAGTCGTTTGAGCTGATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-595s1c1
Sequence:CCGGGAGGAAGAGGATTTCCCTGAACTCGAGTTCAGGGAAATCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-327s1c1
Sequence:CCGGGTGCCCAAGAATACGACAGATCTCGAGATCTGTCGTATTCTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-1051s1c1
Sequence:CCGGCCAGAATGAAGCCTCTGACTTCTCGAGAAGTCAGAGGCTTCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152698
AMER3 MISSION shRNA Lentiviral Transduction Particles
APC membrane recruitment protein 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-1980s1c1
Sequence:CCGGCTGAAGGCTTGTTCTCCTCTACTCGAGTAGAGGAGAACAAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2019s1c1
Sequence:CCGGCGACAACAGATACTTCCGGTACTCGAGTACCGGAAGTATCTGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-625s1c1
Sequence:CCGGGAAGTGCTTTCGGAACCTATTCTCGAGAATAGGTTCCGAAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-655s1c1
Sequence:CCGGGAGAAACAAGACTGAGGACTTCTCGAGAAGTCCTCAGTCTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152698.1-2796s1c1
Sequence:CCGGGCCTAGGACTCAAATCTCTATCTCGAGATAGAGATTTGAGTCCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2020s1c1
Sequence:CCGGGACAACAGATACTTCCGGTAACTCGAGTTACCGGAAGTATCTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-631s1c1
Sequence:CCGGCTTTCGGAACCTATTCCACATCTCGAGATGTGGAATAGGTTCCGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2013s1c1
Sequence:CCGGCCACTTCGACAACAGATACTTCTCGAGAAGTATCTGTTGTCGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-640s1c1
Sequence:CCGGCCTATTCCACATTCGGAGAAACTCGAGTTTCTCCGAATGTGGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-2200s1c1
Sequence:CCGGCCTGAAGATCAGCTCAAACGACTCGAGTCGTTTGAGCTGATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-595s1c1
Sequence:CCGGGAGGAAGAGGATTTCCCTGAACTCGAGTTCAGGGAAATCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-327s1c1
Sequence:CCGGGTGCCCAAGAATACGACAGATCTCGAGATCTGTCGTATTCTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152698.1-1051s1c1
Sequence:CCGGCCAGAATGAAGCCTCTGACTTCTCGAGAAGTCAGAGGCTTCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213727
AMER3 MISSION shRNA Bacterial Glycerol Stock
APC membrane recruitment protein 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213727.1-3751s21c1
Sequence:CCGGGGATGAGGGCTGTAGGTTAAACTCGAGTTTAACCTACAGCCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-1818s21c1
Sequence:CCGGGGTAGTAAGACTCCATCTAAGCTCGAGCTTAGATGGAGTCTTACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-424s21c1
Sequence:CCGGTGATCGACTACCGCCACTTTGCTCGAGCAAAGTGGCGGTAGTCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-1057s21c1
Sequence:CCGGGGCTAGACACATCTGGATTAGCTCGAGCTAATCCAGATGTGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213727
AMER3 MISSION shRNA shRNA Plasmid DNA
APC membrane recruitment protein 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213727.1-3751s21c1
Sequence:CCGGGGATGAGGGCTGTAGGTTAAACTCGAGTTTAACCTACAGCCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-1818s21c1
Sequence:CCGGGGTAGTAAGACTCCATCTAAGCTCGAGCTTAGATGGAGTCTTACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-424s21c1
Sequence:CCGGTGATCGACTACCGCCACTTTGCTCGAGCAAAGTGGCGGTAGTCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-1057s21c1
Sequence:CCGGGGCTAGACACATCTGGATTAGCTCGAGCTAATCCAGATGTGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213727
AMER3 MISSION shRNA Lentiviral Transduction Particles
APC membrane recruitment protein 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213727.1-3751s21c1
Sequence:CCGGGGATGAGGGCTGTAGGTTAAACTCGAGTTTAACCTACAGCCCTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-1818s21c1
Sequence:CCGGGGTAGTAAGACTCCATCTAAGCTCGAGCTTAGATGGAGTCTTACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-424s21c1
Sequence:CCGGTGATCGACTACCGCCACTTTGCTCGAGCAAAGTGGCGGTAGTCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213727.1-1057s21c1
Sequence:CCGGGGCTAGACACATCTGGATTAGCTCGAGCTAATCCAGATGTGTCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks