EMAIL THIS PAGE TO A FRIEND

AMFR

autocrine motility factor receptor, E3 ubiquitin protein ligase

107 Gene Product Result for
Synonyms: GP78 RNF45
UniProtKB ID: Q9UKV5, P26442, Q8IZ70
Gene ID:
Human(267) Summary: This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]
Mouse(23802) autocrine motility factor receptor
Rat(361367) autocrine motility factor receptor, E3 ubiquitin protein ligase
naked mole-rat(101722534) autocrine motility factor receptor, E3 ubiquitin protein ligase
domestic guinea pig(100729655) autocrine motility factor receptor, E3 ubiquitin protein ligase
sheep(101119154) autocrine motility factor receptor, E3 ubiquitin protein ligase
Domestic Rabbit(100342533) autocrine motility factor receptor, E3 ubiquitin protein ligase
Zebrafish(406442) autocrine motility factor receptor
cow(507541) autocrine motility factor receptor
domestic cat(101091066) autocrine motility factor receptor, E3 ubiquitin protein ligase
dog(487269) autocrine motility factor receptor, E3 ubiquitin protein ligase
chicken(415697) autocrine motility factor receptor, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001144 Rosetta Predictions human pricing
XM_001062954 Rosetta Predictions rat pricing
XM_341644 Rosetta Predictions rat pricing
NM_011787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208564 predicted 634
2 SASI_Hs01_00208565 predicted 978
3 SASI_Hs02_00331230 predicted 1341
4 SASI_Hs01_00208566 predicted 2233
5 SASI_Hs01_00208567 predicted 1138
6 SASI_Hs01_00208568 predicted 1362
7 SASI_Hs01_00208569 predicted 1911
8 SASI_Hs01_00208570 predicted 1450
9 SASI_Hs01_00208571 predicted 1313
10 SASI_Hs01_00208572 predicted 833
11 SASI_Hs01_00208573 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305257 predicted 1718
2 SASI_Rn02_00305258 predicted 1252
3 SASI_Rn02_00305259 predicted 312
4 SASI_Rn02_00305260 predicted 1545
5 SASI_Rn02_00305261 predicted 829
6 SASI_Rn02_00305262 predicted 1487
7 SASI_Rn02_00305263 predicted 1464
8 SASI_Rn02_00305264 predicted 460
9 SASI_Rn02_00305265 predicted 267
10 SASI_Rn02_00305266 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393211 predicted 1301
2 SASI_Rn02_00393212 predicted 2144
3 SASI_Rn02_00393213 predicted 1668
4 SASI_Rn02_00393214 predicted 738
5 SASI_Rn02_00393215 predicted 1961
6 SASI_Rn02_00393216 predicted 1900
7 SASI_Rn02_00393217 predicted 1883
8 SASI_Rn02_00393218 predicted 893
9 SASI_Rn02_00393219 predicted 703
10 SASI_Rn02_00393220 predicted 1754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095948 predicted 1875
2 SASI_Mm01_00095949 predicted 1137
3 SASI_Mm01_00095950 predicted 1634
4 SASI_Mm01_00095951 predicted 1268
5 SASI_Mm01_00095952 predicted 419
6 SASI_Mm01_00095953 predicted 1624
7 SASI_Mm01_00095954 predicted 1905
8 SASI_Mm01_00095955 predicted 840
9 SASI_Mm01_00095956 predicted 1405
10 SASI_Mm02_00321437 predicted 1520
11 SASI_Mm01_00095947 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011787
VALIDATED
AMFR MISSION shRNA Bacterial Glycerol Stock
autocrine motility factor receptor, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-415s21c1
Sequence:CCGGTCGTGTGGGTTCTGGTGAATACTCGAGTATTCACCAGAACCCACACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011787.2-2545s21c1
Sequence:CCGGCAAAGTAGCCTACGATTAAATCTCGAGATTTAATCGTAGGCTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-934s21c1
Sequence:CCGGATGTGTATTACACCGACTTTGCTCGAGCAAAGTCGGTGTAATACACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-1014s21c1
Sequence:CCGGGGCAACATCTGGTTATCTATGCTCGAGCATAGATAACCAGATGTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011787.1-3274s1c1
Sequence:CCGGCGGCTCAAATTCTCCACGTATCTCGAGATACGTGGAGAATTTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-1829s1c1
Sequence:CCGGCCGTGGAGATAACAACAGATACTCGAGTATCTGTTGTTATCTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-1200s1c1
Sequence:CCGGCCACATCCACATGCTGTTATTCTCGAGAATAACAGCATGTGGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-2155s1c1
Sequence:CCGGCGAAAGCGGTTCTTAAACAAACTCGAGTTTGTTTAAGAACCGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-670s1c1
Sequence:CCGGGCTAAGCTTATCCAGTGTATTCTCGAGAATACACTGGATAAGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011787
VALIDATED
AMFR MISSION shRNA shRNA Plasmid DNA
autocrine motility factor receptor, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-415s21c1
Sequence:CCGGTCGTGTGGGTTCTGGTGAATACTCGAGTATTCACCAGAACCCACACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011787.2-2545s21c1
Sequence:CCGGCAAAGTAGCCTACGATTAAATCTCGAGATTTAATCGTAGGCTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-934s21c1
Sequence:CCGGATGTGTATTACACCGACTTTGCTCGAGCAAAGTCGGTGTAATACACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-1014s21c1
Sequence:CCGGGGCAACATCTGGTTATCTATGCTCGAGCATAGATAACCAGATGTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011787.1-3274s1c1
Sequence:CCGGCGGCTCAAATTCTCCACGTATCTCGAGATACGTGGAGAATTTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-1829s1c1
Sequence:CCGGCCGTGGAGATAACAACAGATACTCGAGTATCTGTTGTTATCTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-1200s1c1
Sequence:CCGGCCACATCCACATGCTGTTATTCTCGAGAATAACAGCATGTGGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-2155s1c1
Sequence:CCGGCGAAAGCGGTTCTTAAACAAACTCGAGTTTGTTTAAGAACCGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-670s1c1
Sequence:CCGGGCTAAGCTTATCCAGTGTATTCTCGAGAATACACTGGATAAGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011787
VALIDATED
AMFR MISSION shRNA Lentiviral Transduction Particles
autocrine motility factor receptor, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-415s21c1
Sequence:CCGGTCGTGTGGGTTCTGGTGAATACTCGAGTATTCACCAGAACCCACACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011787.2-2545s21c1
Sequence:CCGGCAAAGTAGCCTACGATTAAATCTCGAGATTTAATCGTAGGCTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-934s21c1
Sequence:CCGGATGTGTATTACACCGACTTTGCTCGAGCAAAGTCGGTGTAATACACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011787.2-1014s21c1
Sequence:CCGGGGCAACATCTGGTTATCTATGCTCGAGCATAGATAACCAGATGTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011787.1-3274s1c1
Sequence:CCGGCGGCTCAAATTCTCCACGTATCTCGAGATACGTGGAGAATTTGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-1829s1c1
Sequence:CCGGCCGTGGAGATAACAACAGATACTCGAGTATCTGTTGTTATCTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-1200s1c1
Sequence:CCGGCCACATCCACATGCTGTTATTCTCGAGAATAACAGCATGTGGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-2155s1c1
Sequence:CCGGCGAAAGCGGTTCTTAAACAAACTCGAGTTTGTTTAAGAACCGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011787.1-670s1c1
Sequence:CCGGGCTAAGCTTATCCAGTGTATTCTCGAGAATACACTGGATAAGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144
VALIDATED
AMFR MISSION shRNA Bacterial Glycerol Stock
autocrine motility factor receptor, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144.4-2466s21c1
Sequence:CCGGTCATGCGTACGTCCCACAAATCTCGAGATTTGTGGGACGTACGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1112s21c1
Sequence:CCGGCATGAGGTGCAACGTCGAATTCTCGAGAATTCGACGTTGCACCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1017s21c1
Sequence:CCGGTGGACCTCATGCACCATATTCCTCGAGGAATATGGTGCATGAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1442s21c1
Sequence:CCGGCCTCGCTTAAACCAACACAATCTCGAGATTGTGTTGGTTTAAGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144.4-2234s21c1
Sequence:CCGGTGACTGCATTGCCGCTGTATACTCGAGTATACAGCGGCAATGCAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1524s21c1
Sequence:CCGGTGATGCACACCACCAACATTCCTCGAGGAATGTTGGTGGTGTGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-1250s1c1
Sequence:CCGGAGGAGAGAACTTGGATGAGAACTCGAGTTCTCATCCAAGTTCTCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-972s1c1
Sequence:CCGGCATGAGGTGCAACGTCGAATTCTCGAGAATTCGACGTTGCACCTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-1302s1c1
Sequence:CCGGCCTCGCTTAAACCAACACAATCTCGAGATTGTGTTGGTTTAAGCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144
VALIDATED
AMFR MISSION shRNA shRNA Plasmid DNA
autocrine motility factor receptor, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144.4-2466s21c1
Sequence:CCGGTCATGCGTACGTCCCACAAATCTCGAGATTTGTGGGACGTACGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1112s21c1
Sequence:CCGGCATGAGGTGCAACGTCGAATTCTCGAGAATTCGACGTTGCACCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1017s21c1
Sequence:CCGGTGGACCTCATGCACCATATTCCTCGAGGAATATGGTGCATGAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1442s21c1
Sequence:CCGGCCTCGCTTAAACCAACACAATCTCGAGATTGTGTTGGTTTAAGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144.4-2234s21c1
Sequence:CCGGTGACTGCATTGCCGCTGTATACTCGAGTATACAGCGGCAATGCAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1524s21c1
Sequence:CCGGTGATGCACACCACCAACATTCCTCGAGGAATGTTGGTGGTGTGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-1250s1c1
Sequence:CCGGAGGAGAGAACTTGGATGAGAACTCGAGTTCTCATCCAAGTTCTCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-972s1c1
Sequence:CCGGCATGAGGTGCAACGTCGAATTCTCGAGAATTCGACGTTGCACCTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-1302s1c1
Sequence:CCGGCCTCGCTTAAACCAACACAATCTCGAGATTGTGTTGGTTTAAGCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144
VALIDATED
AMFR MISSION shRNA Lentiviral Transduction Particles
autocrine motility factor receptor, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144.4-2466s21c1
Sequence:CCGGTCATGCGTACGTCCCACAAATCTCGAGATTTGTGGGACGTACGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1112s21c1
Sequence:CCGGCATGAGGTGCAACGTCGAATTCTCGAGAATTCGACGTTGCACCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1017s21c1
Sequence:CCGGTGGACCTCATGCACCATATTCCTCGAGGAATATGGTGCATGAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1442s21c1
Sequence:CCGGCCTCGCTTAAACCAACACAATCTCGAGATTGTGTTGGTTTAAGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144.4-2234s21c1
Sequence:CCGGTGACTGCATTGCCGCTGTATACTCGAGTATACAGCGGCAATGCAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144.4-1524s21c1
Sequence:CCGGTGATGCACACCACCAACATTCCTCGAGGAATGTTGGTGGTGTGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-1250s1c1
Sequence:CCGGAGGAGAGAACTTGGATGAGAACTCGAGTTCTCATCCAAGTTCTCTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-972s1c1
Sequence:CCGGCATGAGGTGCAACGTCGAATTCTCGAGAATTCGACGTTGCACCTCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001144.x-1302s1c1
Sequence:CCGGCCTCGCTTAAACCAACACAATCTCGAGATTGTGTTGGTTTAAGCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)