EMAIL THIS PAGE TO A FRIEND

AMH

anti-Mullerian hormone

Synonyms: MIF MIS
UniProtKB ID: P03971, O75246, Q6GTN3
Gene ID:
Human(268) Summary: Anti-Mullerian hormone is a member of the transforming growth factor-beta gene family which mediates male sexual differentiation. Anti-Mullerian hormone causes the regression of Mullerian ducts which would otherwise differentiate into the uterus and fallopian tubes. Some mutations in the anti-Mullerian hormone result in persistent Mullerian duct syndrome. [provided by RefSeq, Jul 2008]
Mouse(11705) anti-Mullerian hormone
Rat(25378) anti-Mullerian hormone
Zebrafish(493624) anti-Mullerian hormone
dog(485072) anti-Mullerian hormone
domestic cat(101080263) anti-Mullerian hormone
cow(280718) anti-Mullerian hormone
chicken(395887) anti-Mullerian hormone
sheep(101121773) anti-Mullerian hormone
domestic guinea pig(100735034) anti-Mullerian hormone
naked mole-rat(101712009) anti-Mullerian hormone
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108646 Anti-AMH affinity isolated antibody canine, bovine, human, rat, pig, mouse, sheep, guinea pig, horse
immunohistochemistry, western blot pricing
SAB1305442 ANTI-AMH (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB2100114 Anti-AMH antibody produced in rabbit affinity isolated antibody bovine, mouse, human, horse, pig, rat, canine, guinea pig
western blot pricing
SAB4300831 Anti-AMH antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000479 Rosetta Predictions human pricing
NM_012902 Rosetta Predictions rat pricing
NM_007445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159623 predicted 799
2 SASI_Hs01_00159624 predicted 1652
3 SASI_Hs01_00159626 predicted 278
4 SASI_Hs01_00159627 predicted 790
5 SASI_Hs01_00159628 predicted 636
6 SASI_Hs01_00159629 predicted 637
7 SASI_Hs01_00159630 predicted 1665
8 SASI_Hs01_00159631 predicted 1658
9 SASI_Hs01_00159632 predicted 320
10 SASI_Hs01_00159625 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067772 predicted 620
2 SASI_Rn01_00067773 predicted 1381
3 SASI_Rn01_00067774 predicted 568
4 SASI_Rn01_00067775 predicted 894
5 SASI_Rn01_00067776 predicted 1401
6 SASI_Rn01_00067777 predicted 383
7 SASI_Rn01_00067778 predicted 281
8 SASI_Rn01_00067779 predicted 549
9 SASI_Rn01_00067780 predicted 691
10 SASI_Rn02_00260430 predicted 546
11 SASI_Rn01_00067771 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026664 predicted 669
2 SASI_Mm02_00311623 predicted 700
3 SASI_Mm01_00026665 predicted 216
4 SASI_Mm01_00026666 predicted 670
5 SASI_Mm01_00026667 predicted 562
6 SASI_Mm01_00026668 predicted 894
7 SASI_Mm01_00026669 predicted 547
8 SASI_Mm01_00026670 predicted 386
9 SASI_Mm01_00026671 predicted 696
10 SASI_Mm01_00026673 predicted 356
11 SASI_Mm01_00026672 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000479
AMH MISSION shRNA Bacterial Glycerol Stock
anti-Mullerian hormone
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-601s1c1
Sequence:CCGGGTGGTCCTACACCTGGAGGAACTCGAGTTCCTCCAGGTGTAGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-1651s1c1
Sequence:CCGGGAGACCTACCAGGCCAACAATCTCGAGATTGTTGGCCTGGTAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-318s1c1
Sequence:CCGGCCTCATCTTCCGAGAAGACTTCTCGAGAAGTCTTCTCGGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-633s1c1
Sequence:CCGGGCCAACACCCTCGCTGAGGTTCTCGAGAACCTCAGCGAGGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-1689s1c1
Sequence:CCGGCTGGCCTCAGTCCGACCGCAACTCGAGTTGCGGTCGGACTGAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-1674s21c1
Sequence:CCGGCAACAATTGCCAGGGCGTGTGCTCGAGCACACGCCCTGGCAATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-628s21c1
Sequence:CCGGGAAGTGACCTGGGAGCCAACACTCGAGTGTTGGCTCCCAGGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-1736s21c1
Sequence:CCGGACGTGGTGCTGCTGCTGAAGACTCGAGTCTTCAGCAGCAGCACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-801s21c1
Sequence:CCGGCTACCTGGTGTTAGCGGTGGACTCGAGTCCACCGCTAACACCAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-935s21c1
Sequence:CCGGACCGCTGCTTCACACGGATGACTCGAGTCATCCGTGTGAAGCAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000479
AMH MISSION shRNA shRNA Plasmid DNA
anti-Mullerian hormone
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-601s1c1
Sequence:CCGGGTGGTCCTACACCTGGAGGAACTCGAGTTCCTCCAGGTGTAGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-1651s1c1
Sequence:CCGGGAGACCTACCAGGCCAACAATCTCGAGATTGTTGGCCTGGTAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-318s1c1
Sequence:CCGGCCTCATCTTCCGAGAAGACTTCTCGAGAAGTCTTCTCGGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-633s1c1
Sequence:CCGGGCCAACACCCTCGCTGAGGTTCTCGAGAACCTCAGCGAGGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-1689s1c1
Sequence:CCGGCTGGCCTCAGTCCGACCGCAACTCGAGTTGCGGTCGGACTGAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-1674s21c1
Sequence:CCGGCAACAATTGCCAGGGCGTGTGCTCGAGCACACGCCCTGGCAATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-628s21c1
Sequence:CCGGGAAGTGACCTGGGAGCCAACACTCGAGTGTTGGCTCCCAGGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-1736s21c1
Sequence:CCGGACGTGGTGCTGCTGCTGAAGACTCGAGTCTTCAGCAGCAGCACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-801s21c1
Sequence:CCGGCTACCTGGTGTTAGCGGTGGACTCGAGTCCACCGCTAACACCAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-935s21c1
Sequence:CCGGACCGCTGCTTCACACGGATGACTCGAGTCATCCGTGTGAAGCAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000479
AMH MISSION shRNA Lentiviral Transduction Particles
anti-Mullerian hormone
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-601s1c1
Sequence:CCGGGTGGTCCTACACCTGGAGGAACTCGAGTTCCTCCAGGTGTAGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-1651s1c1
Sequence:CCGGGAGACCTACCAGGCCAACAATCTCGAGATTGTTGGCCTGGTAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-318s1c1
Sequence:CCGGCCTCATCTTCCGAGAAGACTTCTCGAGAAGTCTTCTCGGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-633s1c1
Sequence:CCGGGCCAACACCCTCGCTGAGGTTCTCGAGAACCTCAGCGAGGGTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000479.2-1689s1c1
Sequence:CCGGCTGGCCTCAGTCCGACCGCAACTCGAGTTGCGGTCGGACTGAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-1674s21c1
Sequence:CCGGCAACAATTGCCAGGGCGTGTGCTCGAGCACACGCCCTGGCAATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-628s21c1
Sequence:CCGGGAAGTGACCTGGGAGCCAACACTCGAGTGTTGGCTCCCAGGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-1736s21c1
Sequence:CCGGACGTGGTGCTGCTGCTGAAGACTCGAGTCTTCAGCAGCAGCACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-801s21c1
Sequence:CCGGCTACCTGGTGTTAGCGGTGGACTCGAGTCCACCGCTAACACCAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000479.3-935s21c1
Sequence:CCGGACCGCTGCTTCACACGGATGACTCGAGTCATCCGTGTGAAGCAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007445
AMH MISSION shRNA Bacterial Glycerol Stock
anti-Mullerian hormone
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-483s1c1
Sequence:CCGGGCCCTGTTAGTGCTATACTCTCTCGAGAGAGTATAGCACTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-574s1c1
Sequence:CCGGACACCCGCTATTTGGTGCTAACTCGAGTTAGCACCAAATAGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-694s1c1
Sequence:CCGGCCTTTCTATTTGGCTCTGATTCTCGAGAATCAGAGCCAAATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-1409s1c1
Sequence:CCGGCGCGGAGCGTTCAGTGCTCATCTCGAGATGAGCACTGAACGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-381s1c1
Sequence:CCGGCAGCAGTTGCTAGTCCTACATCTCGAGATGTAGGACTAGCAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007445
AMH MISSION shRNA shRNA Plasmid DNA
anti-Mullerian hormone
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-483s1c1
Sequence:CCGGGCCCTGTTAGTGCTATACTCTCTCGAGAGAGTATAGCACTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-574s1c1
Sequence:CCGGACACCCGCTATTTGGTGCTAACTCGAGTTAGCACCAAATAGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-694s1c1
Sequence:CCGGCCTTTCTATTTGGCTCTGATTCTCGAGAATCAGAGCCAAATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-1409s1c1
Sequence:CCGGCGCGGAGCGTTCAGTGCTCATCTCGAGATGAGCACTGAACGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-381s1c1
Sequence:CCGGCAGCAGTTGCTAGTCCTACATCTCGAGATGTAGGACTAGCAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007445
AMH MISSION shRNA Lentiviral Transduction Particles
anti-Mullerian hormone
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-483s1c1
Sequence:CCGGGCCCTGTTAGTGCTATACTCTCTCGAGAGAGTATAGCACTAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-574s1c1
Sequence:CCGGACACCCGCTATTTGGTGCTAACTCGAGTTAGCACCAAATAGCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-694s1c1
Sequence:CCGGCCTTTCTATTTGGCTCTGATTCTCGAGAATCAGAGCCAAATAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-1409s1c1
Sequence:CCGGCGCGGAGCGTTCAGTGCTCATCTCGAGATGAGCACTGAACGCTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007445.1-381s1c1
Sequence:CCGGCAGCAGTTGCTAGTCCTACATCTCGAGATGTAGGACTAGCAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks