EMAIL THIS PAGE TO A FRIEND

AMHR2

anti-Mullerian hormone receptor, type II

77 Gene Product Result for
Synonyms: AMHR MISR2 MISRII MRII
Gene ID:
Human(269) Summary: This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
Mouse(110542) anti-Mullerian hormone type 2 receptor
Rat(29530) anti-Mullerian hormone receptor, type II
naked mole-rat(101698756) anti-Mullerian hormone receptor, type II
domestic guinea pig(100726224) anti-Mullerian hormone receptor, type II
sheep(101109693) anti-Mullerian hormone receptor, type II
Domestic Rabbit(100009599) anti-Mullerian hormone receptor, type II
cow(514963) anti-Mullerian hormone receptor, type II
domestic cat(101085902) anti-Mullerian hormone receptor, type II
Horse(100063905) anti-Mullerian hormone receptor, type II
dog(486506) anti-Mullerian hormone receptor, type II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1584 Human MIS RII ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020547 Rosetta Predictions human pricing
NM_030998 Rosetta Predictions rat pricing
NM_144547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353584 predicted 1534
2 SASI_Hs01_00094512 predicted 328
3 SASI_Hs02_00353585 predicted 1313
4 SASI_Hs01_00094515 predicted 229
5 SASI_Hs01_00094516 predicted 329
6 SASI_Hs01_00094517 predicted 1563
7 SASI_Hs02_00353586 predicted 1591
8 SASI_Hs02_00353587 predicted 1353
9 SASI_Hs02_00353588 predicted 1251
10 SASI_Hs01_00094508 predicted 932
11 SASI_Hs01_00094509 predicted 1091
12 SASI_Hs01_00094510 predicted 820
13 SASI_Hs01_00094511 predicted 1100
14 SASI_Hs01_00094513 predicted 1242
15 SASI_Hs01_00094514 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039633 predicted 406
2 SASI_Rn01_00039634 predicted 558
3 SASI_Rn01_00039635 predicted 1301
4 SASI_Rn01_00039637 predicted 1291
5 SASI_Rn01_00039638 predicted 1095
6 SASI_Rn01_00039639 predicted 648
7 SASI_Rn01_00039640 predicted 284
8 SASI_Rn02_00264171 predicted 1070
9 SASI_Rn01_00039641 predicted 885
10 SASI_Rn02_00264172 predicted 1077
11 SASI_Rn01_00039636 predicted 681
12 SASI_Rn01_00039642 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166084 predicted 1332
2 SASI_Mm01_00166085 predicted 263
3 SASI_Mm02_00340086 predicted 412
4 SASI_Mm01_00166086 predicted 563
5 SASI_Mm01_00166087 predicted 647
6 SASI_Mm01_00166088 predicted 1046
7 SASI_Mm01_00166089 predicted 860
8 SASI_Mm01_00166091 predicted 1060
9 SASI_Mm01_00166092 predicted 1203
10 SASI_Mm01_00166093 predicted 992
11 SASI_Mm01_00166090 predicted 1323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144547
AMHR2 MISSION shRNA Bacterial Glycerol Stock
anti-Mullerian hormone receptor, type II
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-805s21c1
Sequence:CCGGGACCATATCGTTCGCTTTATCCTCGAGGATAAAGCGAACGATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-649s21c1
Sequence:CCGGCTGCGTTTCTCCCAGGTAATCCTCGAGGATTACCTGGGAGAAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-1254s21c1
Sequence:CCGGTCTCCAGAGAGCGGATGTTTACTCGAGTAAACATCCGCTCTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-393s21c1
Sequence:CCGGTGACTTCTGCAATGCCAATTACTCGAGTAATTGGCATTGCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-507s1c1
Sequence:CCGGCCTGGGAATGTTTCTCGTGTTCTCGAGAACACGAGAAACATTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-801s1c1
Sequence:CCGGGCATGACCATATCGTTCGCTTCTCGAGAAGCGAACGATATGGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-1270s1c1
Sequence:CCGGGTTTACTCTCTGGCGCTACTACTCGAGTAGTAGCGCCAGAGAGTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-1105s1c1
Sequence:CCGGGCCTTGGTACTCCCTGGTCTTCTCGAGAAGACCAGGGAGTACCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-648s1c1
Sequence:CCGGGCTGCGTTTCTCCCAGGTAATCTCGAGATTACCTGGGAGAAACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144547
AMHR2 MISSION shRNA shRNA Plasmid DNA
anti-Mullerian hormone receptor, type II
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-805s21c1
Sequence:CCGGGACCATATCGTTCGCTTTATCCTCGAGGATAAAGCGAACGATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-649s21c1
Sequence:CCGGCTGCGTTTCTCCCAGGTAATCCTCGAGGATTACCTGGGAGAAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-1254s21c1
Sequence:CCGGTCTCCAGAGAGCGGATGTTTACTCGAGTAAACATCCGCTCTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-393s21c1
Sequence:CCGGTGACTTCTGCAATGCCAATTACTCGAGTAATTGGCATTGCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-507s1c1
Sequence:CCGGCCTGGGAATGTTTCTCGTGTTCTCGAGAACACGAGAAACATTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-801s1c1
Sequence:CCGGGCATGACCATATCGTTCGCTTCTCGAGAAGCGAACGATATGGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-1270s1c1
Sequence:CCGGGTTTACTCTCTGGCGCTACTACTCGAGTAGTAGCGCCAGAGAGTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-1105s1c1
Sequence:CCGGGCCTTGGTACTCCCTGGTCTTCTCGAGAAGACCAGGGAGTACCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-648s1c1
Sequence:CCGGGCTGCGTTTCTCCCAGGTAATCTCGAGATTACCTGGGAGAAACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144547
AMHR2 MISSION shRNA Lentiviral Transduction Particles
anti-Mullerian hormone receptor, type II
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-805s21c1
Sequence:CCGGGACCATATCGTTCGCTTTATCCTCGAGGATAAAGCGAACGATATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-649s21c1
Sequence:CCGGCTGCGTTTCTCCCAGGTAATCCTCGAGGATTACCTGGGAGAAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-1254s21c1
Sequence:CCGGTCTCCAGAGAGCGGATGTTTACTCGAGTAAACATCCGCTCTCTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144547.1-393s21c1
Sequence:CCGGTGACTTCTGCAATGCCAATTACTCGAGTAATTGGCATTGCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-507s1c1
Sequence:CCGGCCTGGGAATGTTTCTCGTGTTCTCGAGAACACGAGAAACATTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-801s1c1
Sequence:CCGGGCATGACCATATCGTTCGCTTCTCGAGAAGCGAACGATATGGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-1270s1c1
Sequence:CCGGGTTTACTCTCTGGCGCTACTACTCGAGTAGTAGCGCCAGAGAGTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-1105s1c1
Sequence:CCGGGCCTTGGTACTCCCTGGTCTTCTCGAGAAGACCAGGGAGTACCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144547.1-648s1c1
Sequence:CCGGGCTGCGTTTCTCCCAGGTAATCTCGAGATTACCTGGGAGAAACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020547
AMHR2 MISSION shRNA Bacterial Glycerol Stock
anti-Mullerian hormone receptor, type II
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-419s21c1
Sequence:CCGGTGACTTCTGCAATGCCAATTACTCGAGTAATTGGCATTGCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-842s21c1
Sequence:CCGGCGACCACATTGTCCGATTTATCTCGAGATAAATCGGACAATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-1037s21c1
Sequence:CCGGCTGGCAGAATGGCCAATATAACTCGAGTTATATTGGCCATTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1255s1c1
Sequence:CCGGGACAAGACTCTGGACCTACAGCTCGAGCTGTAGGTCCAGAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1666s1c1
Sequence:CCGGCCAGAAGACTGTACTTCAATTCTCGAGAATTGAAGTACAGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1089s1c1
Sequence:CCGGGAATGTGCTCATTCGGGAAGACTCGAGTCTTCCCGAATGAGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-1292s1c1
Sequence:CCGGTCCGACGAGCTGATATTTACTCTCGAGAGTAAATATCAGCTCGTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-586s1c1
Sequence:CCGGCTACAGCGAAAGAACTACAGACTCGAGTCTGTAGTTCTTTCGCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-805s1c1
Sequence:CCGGGAGAGAGCATTGTACGAACTTCTCGAGAAGTTCGTACAATGCTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-1528s1c1
Sequence:CCGGCTAGAAGACTGTTGGGATGCACTCGAGTGCATCCCAACAGTCTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-588s1c1
Sequence:CCGGACAGCGAAAGAACTACAGAGTCTCGAGACTCTGTAGTTCTTTCGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020547
AMHR2 MISSION shRNA shRNA Plasmid DNA
anti-Mullerian hormone receptor, type II
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-419s21c1
Sequence:CCGGTGACTTCTGCAATGCCAATTACTCGAGTAATTGGCATTGCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-842s21c1
Sequence:CCGGCGACCACATTGTCCGATTTATCTCGAGATAAATCGGACAATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-1037s21c1
Sequence:CCGGCTGGCAGAATGGCCAATATAACTCGAGTTATATTGGCCATTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1255s1c1
Sequence:CCGGGACAAGACTCTGGACCTACAGCTCGAGCTGTAGGTCCAGAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1666s1c1
Sequence:CCGGCCAGAAGACTGTACTTCAATTCTCGAGAATTGAAGTACAGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1089s1c1
Sequence:CCGGGAATGTGCTCATTCGGGAAGACTCGAGTCTTCCCGAATGAGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-1292s1c1
Sequence:CCGGTCCGACGAGCTGATATTTACTCTCGAGAGTAAATATCAGCTCGTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-586s1c1
Sequence:CCGGCTACAGCGAAAGAACTACAGACTCGAGTCTGTAGTTCTTTCGCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-805s1c1
Sequence:CCGGGAGAGAGCATTGTACGAACTTCTCGAGAAGTTCGTACAATGCTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-1528s1c1
Sequence:CCGGCTAGAAGACTGTTGGGATGCACTCGAGTGCATCCCAACAGTCTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-588s1c1
Sequence:CCGGACAGCGAAAGAACTACAGAGTCTCGAGACTCTGTAGTTCTTTCGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020547
AMHR2 MISSION shRNA Lentiviral Transduction Particles
anti-Mullerian hormone receptor, type II
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-419s21c1
Sequence:CCGGTGACTTCTGCAATGCCAATTACTCGAGTAATTGGCATTGCAGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-842s21c1
Sequence:CCGGCGACCACATTGTCCGATTTATCTCGAGATAAATCGGACAATGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020547.2-1037s21c1
Sequence:CCGGCTGGCAGAATGGCCAATATAACTCGAGTTATATTGGCCATTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1255s1c1
Sequence:CCGGGACAAGACTCTGGACCTACAGCTCGAGCTGTAGGTCCAGAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1666s1c1
Sequence:CCGGCCAGAAGACTGTACTTCAATTCTCGAGAATTGAAGTACAGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020547.1-1089s1c1
Sequence:CCGGGAATGTGCTCATTCGGGAAGACTCGAGTCTTCCCGAATGAGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-1292s1c1
Sequence:CCGGTCCGACGAGCTGATATTTACTCTCGAGAGTAAATATCAGCTCGTCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-586s1c1
Sequence:CCGGCTACAGCGAAAGAACTACAGACTCGAGTCTGTAGTTCTTTCGCTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-805s1c1
Sequence:CCGGGAGAGAGCATTGTACGAACTTCTCGAGAAGTTCGTACAATGCTCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-1528s1c1
Sequence:CCGGCTAGAAGACTGTTGGGATGCACTCGAGTGCATCCCAACAGTCTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020547.x-588s1c1
Sequence:CCGGACAGCGAAAGAACTACAGAGTCTCGAGACTCTGTAGTTCTTTCGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks