EMAIL THIS PAGE TO A FRIEND

AMICA1

adhesion molecule, interacts with CXADR antigen 1

Synonyms: AMICA CREA7-1 CREA7-4 Gm638 JAML
Gene ID:
Mouse(270152) adhesion molecule, interacts with CXADR antigen 1
Rat(315610) adhesion molecule, interacts with CXADR antigen 1
chicken(419777) adhesion molecule, interacts with CXADR antigen 1
cow(509575) adhesion molecule, interacts with CXADR antigen 1
dog(610790) adhesion molecule, interacts with CXADR antigen 1
domestic cat(101088515) adhesion molecule, interacts with CXADR antigen 1
sheep(101121705) adhesion molecule, interacts with CXADR antigen 1
domestic guinea pig(100728339) adhesion molecule, interacts with CXADR antigen 1
naked mole-rat(101709422) adhesion molecule, interacts with CXADR antigen 1
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0604 Human AMICA1 / Junctional Adhesion Molecule-like ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153206 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077361 MISSION® esiRNA esiRNA human AMICA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098526 Rosetta Predictions human pricing
NM_153206 Rosetta Predictions human pricing
XM_001067982 Rosetta Predictions rat pricing
XM_236198 Rosetta Predictions rat pricing
NM_001005421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319317 predicted 1007
2 SASI_Hs02_00319318 predicted 1213
3 SASI_Hs02_00319319 predicted 1413
4 SASI_Hs02_00319320 predicted 702
5 SASI_Hs02_00319321 predicted 585
6 SASI_Hs02_00319322 predicted 984
7 SASI_Hs02_00319323 predicted 1269
8 SASI_Hs02_00319324 predicted 1114
9 SASI_Hs02_00319325 predicted 1036
10 SASI_Hs02_00319326 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367047 predicted 1245
2 SASI_Hs01_00134370 predicted 1457
3 SASI_Hs01_00134371 predicted 1652
4 SASI_Hs02_00367048 predicted 944
5 SASI_Hs01_00134373 predicted 825
6 SASI_Hs01_00134376 predicted 1217
7 SASI_Hs01_00134378 predicted 1499
8 SASI_Hs02_00367049 predicted 1354
9 SASI_Hs02_00367050 predicted 1272
10 SASI_Hs02_00367051 predicted 897
11 SASI_Hs01_00134372 predicted 1104
12 SASI_Hs01_00134374 predicted 1247
13 SASI_Hs01_00134375 predicted 626
14 SASI_Hs01_00134377 predicted 754
15 SASI_Hs01_00134379 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323036 predicted 796
2 SASI_Rn02_00323037 predicted 742
3 SASI_Rn02_00323038 predicted 334
4 SASI_Rn02_00323039 predicted 835
5 SASI_Rn02_00323040 predicted 346
6 SASI_Rn02_00323041 predicted 873
7 SASI_Rn02_00323042 predicted 580
8 SASI_Rn02_00323043 predicted 267
9 SASI_Rn02_00323044 predicted 633
10 SASI_Rn02_00323045 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389863 predicted 1057
2 SASI_Rn02_00389864 predicted 924
3 SASI_Rn02_00389865 predicted 876
4 SASI_Rn02_00389866 predicted 1016
5 SASI_Rn02_00389867 predicted 877
6 SASI_Rn02_00389868 predicted 958
7 SASI_Rn02_00389869 predicted 1043
8 SASI_Rn02_00389870 predicted 1052
9 SASI_Rn02_00389871 predicted 1019
10 SASI_Rn02_00389872 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286579 predicted 850
2 SASI_Mm01_00185425 predicted 916
3 SASI_Mm02_00286580 predicted 879
4 SASI_Mm02_00286581 predicted 432
5 SASI_Mm02_00286582 predicted 873
6 SASI_Mm02_00286583 predicted 338
7 SASI_Mm02_00286584 predicted 247
8 SASI_Mm02_00286585 predicted 1060
9 SASI_Mm02_00286586 predicted 397
10 SASI_Mm02_00286587 predicted 1147
11 SASI_Mm01_00185424 predicted 889
12 SASI_Mm01_00185426 predicted 988
13 SASI_Mm01_00185427 predicted 1017
14 SASI_Mm01_00185428 predicted 640
15 SASI_Mm01_00185429 predicted 802
16 SASI_Mm01_00185430 predicted 729
17 SASI_Mm01_00185431 predicted 493
18 SASI_Mm01_00185432 predicted 938
19 SASI_Mm01_00185433 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005421
AMICA1 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule, interacts with CXADR antigen 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-876s1c1
Sequence:CCGGCCGCAATGATGGCTCAATCAACTCGAGTTGATTGAGCCATCATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005421.2-1436s1c1
Sequence:CCGGGAGAAGGAGGAGAGACTCTTTCTCGAGAAAGAGTCTCTCCTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-1160s1c1
Sequence:CCGGGCTCAGTAAGTTCTATGGCTTCTCGAGAAGCCATAGAACTTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-450s1c1
Sequence:CCGGGCTGTTCTACTATTCCAACCTCTCGAGAGGTTGGAATAGTAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-1301s1c1
Sequence:CCGGCCATGAATCCAGTTTGGCCTTCTCGAGAAGGCCAAACTGGATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005421
AMICA1 MISSION shRNA shRNA Plasmid DNA
adhesion molecule, interacts with CXADR antigen 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-876s1c1
Sequence:CCGGCCGCAATGATGGCTCAATCAACTCGAGTTGATTGAGCCATCATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005421.2-1436s1c1
Sequence:CCGGGAGAAGGAGGAGAGACTCTTTCTCGAGAAAGAGTCTCTCCTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-1160s1c1
Sequence:CCGGGCTCAGTAAGTTCTATGGCTTCTCGAGAAGCCATAGAACTTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-450s1c1
Sequence:CCGGGCTGTTCTACTATTCCAACCTCTCGAGAGGTTGGAATAGTAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-1301s1c1
Sequence:CCGGCCATGAATCCAGTTTGGCCTTCTCGAGAAGGCCAAACTGGATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005421
AMICA1 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule, interacts with CXADR antigen 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-876s1c1
Sequence:CCGGCCGCAATGATGGCTCAATCAACTCGAGTTGATTGAGCCATCATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005421.2-1436s1c1
Sequence:CCGGGAGAAGGAGGAGAGACTCTTTCTCGAGAAAGAGTCTCTCCTCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-1160s1c1
Sequence:CCGGGCTCAGTAAGTTCTATGGCTTCTCGAGAAGCCATAGAACTTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-450s1c1
Sequence:CCGGGCTGTTCTACTATTCCAACCTCTCGAGAGGTTGGAATAGTAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005421.2-1301s1c1
Sequence:CCGGCCATGAATCCAGTTTGGCCTTCTCGAGAAGGCCAAACTGGATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153206
AMICA1 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule, interacts with CXADR antigen 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1279s1c1
Sequence:CCGGCCCTGTTCTGATATTGATCGTCTCGAGACGATCAATATCAGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153206.1-1704s1c1
Sequence:CCGGCCTGTCTCATTGTTTGGTCAACTCGAGTTGACCAAACAATGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1532s1c1
Sequence:CCGGGATCGGAACAACTCACTTGAACTCGAGTTCAAGTGAGTTGTTCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153206.1-1722s1c1
Sequence:CCGGCAATACACTGAAGATGGAGAACTCGAGTTCTCCATCTTCAGTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-905s1c1
Sequence:CCGGGTGACCAAGGTAGAATGGATACTCGAGTATCCATTCTACCTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-855s1c1
Sequence:CCGGGTGGATTGATTCAGATGGGATCTCGAGATCCCATCTGAATCAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1360s1c1
Sequence:CCGGGAAGACTAATCCAGAGATAAACTCGAGTTTATCTCTGGATTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-956s1c1
Sequence:CCGGGTATTTCGTTACTACCACAAACTCGAGTTTGTGGTAGTAACGAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153206.2-736s21c1
Sequence:CCGGGGCTGACCAGGGAACCTATATCTCGAGATATAGGTTCCCTGGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153206.2-1227s21c1
Sequence:CCGGGTAATCAGTTGGTGATCATTGCTCGAGCAATGATCACCAACTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153206
AMICA1 MISSION shRNA shRNA Plasmid DNA
adhesion molecule, interacts with CXADR antigen 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1279s1c1
Sequence:CCGGCCCTGTTCTGATATTGATCGTCTCGAGACGATCAATATCAGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153206.1-1704s1c1
Sequence:CCGGCCTGTCTCATTGTTTGGTCAACTCGAGTTGACCAAACAATGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1532s1c1
Sequence:CCGGGATCGGAACAACTCACTTGAACTCGAGTTCAAGTGAGTTGTTCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153206.1-1722s1c1
Sequence:CCGGCAATACACTGAAGATGGAGAACTCGAGTTCTCCATCTTCAGTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-905s1c1
Sequence:CCGGGTGACCAAGGTAGAATGGATACTCGAGTATCCATTCTACCTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-855s1c1
Sequence:CCGGGTGGATTGATTCAGATGGGATCTCGAGATCCCATCTGAATCAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1360s1c1
Sequence:CCGGGAAGACTAATCCAGAGATAAACTCGAGTTTATCTCTGGATTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-956s1c1
Sequence:CCGGGTATTTCGTTACTACCACAAACTCGAGTTTGTGGTAGTAACGAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153206.2-736s21c1
Sequence:CCGGGGCTGACCAGGGAACCTATATCTCGAGATATAGGTTCCCTGGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153206.2-1227s21c1
Sequence:CCGGGTAATCAGTTGGTGATCATTGCTCGAGCAATGATCACCAACTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153206
AMICA1 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule, interacts with CXADR antigen 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1279s1c1
Sequence:CCGGCCCTGTTCTGATATTGATCGTCTCGAGACGATCAATATCAGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161824    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153206.1-1704s1c1
Sequence:CCGGCCTGTCTCATTGTTTGGTCAACTCGAGTTGACCAAACAATGAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1532s1c1
Sequence:CCGGGATCGGAACAACTCACTTGAACTCGAGTTCAAGTGAGTTGTTCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160618    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153206.1-1722s1c1
Sequence:CCGGCAATACACTGAAGATGGAGAACTCGAGTTCTCCATCTTCAGTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-905s1c1
Sequence:CCGGGTGACCAAGGTAGAATGGATACTCGAGTATCCATTCTACCTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-855s1c1
Sequence:CCGGGTGGATTGATTCAGATGGGATCTCGAGATCCCATCTGAATCAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-1360s1c1
Sequence:CCGGGAAGACTAATCCAGAGATAAACTCGAGTTTATCTCTGGATTAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153206.1-956s1c1
Sequence:CCGGGTATTTCGTTACTACCACAAACTCGAGTTTGTGGTAGTAACGAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153206.2-736s21c1
Sequence:CCGGGGCTGACCAGGGAACCTATATCTCGAGATATAGGTTCCCTGGTCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153206.2-1227s21c1
Sequence:CCGGGTAATCAGTTGGTGATCATTGCTCGAGCAATGATCACCAACTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks