EMAIL THIS PAGE TO A FRIEND

AMIGO1

adhesion molecule with Ig-like domain 1

Synonyms: AMIGO AMIGO-1
UniProtKB ID: Q86WK6, B4DIM3, Q8IW71, Q9ULQ7
Gene ID:
Mouse(229715) adhesion molecule with Ig like domain 1
Rat(295365) adhesion molecule with Ig like domain 1
naked mole-rat(101701990) adhesion molecule with Ig-like domain 1
domestic guinea pig(100719094) adhesion molecule with Ig-like domain 1
sheep(101106213) adhesion molecule with Ig-like domain 1
Domestic Rabbit(100337992) adhesion molecule with Ig-like domain 1
Zebrafish(100144409) adhesion molecule with Ig-like domain 1
domestic cat(101099819) adhesion molecule with Ig-like domain 1
cow(524284) adhesion molecule with Ig-like domain 1
Horse(100058158) adhesion molecule with Ig-like domain 1
dog(490120) adhesion molecule with Ig-like domain 1
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101857 Anti-AMIGO1 (271-285) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1101858 Anti-AMIGO1 (466-480) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2701281 Anti-AMIGO1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA046152 Anti-AMIGO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3501062 Anti-AMIGO1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB5201059 Monoclonal Anti-Amigo-1 - Alkaline Phosphatase antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201060 Monoclonal Anti-Amigo-1 - Apc antibody produced in mouse clone S86-36, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201051 Monoclonal Anti-Amigo-1 - Atto 390 antibody produced in mouse clone S86-36, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201052 Monoclonal Anti-Amigo-1 - Atto 488 antibody produced in mouse clone S86-36, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201053 Monoclonal Anti-Amigo-1 - Atto 565 antibody produced in mouse clone S86-36, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201054 Monoclonal Anti-Amigo-1 - Atto 594 antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201055 Monoclonal Anti-Amigo-1 - Atto 633 antibody produced in mouse clone S86-36, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201056 Monoclonal Anti-Amigo-1 - Atto 655 antibody produced in mouse clone S86-36, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201057 Monoclonal Anti-Amigo-1 - Atto 680 antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201058 Monoclonal Anti-Amigo-1 - Atto 700 antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201061 Monoclonal Anti-Amigo-1 - Biotin antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201062 Monoclonal Anti-Amigo-1 - Fitc antibody produced in mouse clone S86-36, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201063 Monoclonal Anti-Amigo-1 - Hrp antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201064 Monoclonal Anti-Amigo-1 - Pe/Atto 594 antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201065 Monoclonal Anti-Amigo-1 - Percp antibody produced in mouse clone S86-36, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201066 Monoclonal Anti-Amigo-1 - Rpe antibody produced in mouse clone S86-36, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201067 Monoclonal Anti-Amigo-1 - Streptavidin antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201050 Monoclonal Anti-Amigo-1 antibody produced in mouse clone S86-36, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1260 Human AmiGO ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020703 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020703 Rosetta Predictions human pricing
NM_206881 Rosetta Predictions rat pricing
NM_001004293 Rosetta Predictions mouse pricing
NM_146137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353709 predicted 550
2 SASI_Hs01_00026237 predicted 1150
3 SASI_Hs01_00026238 predicted 1287
4 SASI_Hs01_00026239 predicted 1231
5 SASI_Hs01_00026241 predicted 1143
6 SASI_Hs01_00026242 predicted 1489
7 SASI_Hs01_00026243 predicted 1833
8 SASI_Hs01_00026244 predicted 1536
9 SASI_Hs01_00026245 predicted 1643
10 SASI_Hs01_00026246 predicted 960
11 SASI_Hs01_00026240 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065550 predicted 397
2 SASI_Rn01_00065551 predicted 507
3 SASI_Rn01_00065552 predicted 498
4 SASI_Rn01_00065553 predicted 661
5 SASI_Rn01_00065554 predicted 758
6 SASI_Rn01_00065555 predicted 441
7 SASI_Rn01_00065557 predicted 519
8 SASI_Rn01_00065559 predicted 481
9 SASI_Rn02_00270394 predicted 955
10 SASI_Rn02_00270395 predicted 1209
11 SASI_Rn01_00065556 predicted 286
12 SASI_Rn01_00065558 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286517 predicted 976
2 SASI_Mm01_00099445 predicted 1041
3 SASI_Mm01_00099446 predicted 1143
4 SASI_Mm01_00099447 predicted 916
5 SASI_Mm01_00099448 predicted 846
6 SASI_Mm02_00286518 predicted 975
7 SASI_Mm01_00099449 predicted 1813
8 SASI_Mm01_00099451 predicted 1854
9 SASI_Mm01_00099452 predicted 1834
10 SASI_Mm01_00099453 predicted 1928
11 SASI_Mm01_00099450 predicted 1632
12 SASI_Mm01_00099454 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341827 predicted 1012
2 SASI_Mm01_00173948 predicted 1078
3 SASI_Mm01_00173949 predicted 1186
4 SASI_Mm01_00173950 predicted 953
5 SASI_Mm01_00173951 predicted 881
6 SASI_Mm02_00341828 predicted 1012
7 SASI_Mm01_00173952 predicted 1857
8 SASI_Mm01_00173954 predicted 1889
9 SASI_Mm01_00173955 predicted 1866
10 SASI_Mm01_00173956 predicted 1960
11 SASI_Mm01_00173953 predicted 1669
12 SASI_Mm01_00173957 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020703
AMIGO1 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule with Ig-like domain 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-1275s1c1
Sequence:CCGGGTGCTAGATGAGGTGACCAATCTCGAGATTGGTCACCTCATCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020703.1-2088s1c1
Sequence:CCGGGAAGAGAAGCATGTCTGAGTTCTCGAGAACTCAGACATGCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-767s1c1
Sequence:CCGGGCTGCTCTACAATAACCACATCTCGAGATGTGGTTATTGTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-833s1c1
Sequence:CCGGGAAACTCTACTTGAGCCAGAACTCGAGTTCTGGCTCAAGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-1130s1c1
Sequence:CCGGCAATGTCTTCAACCTGAGTTTCTCGAGAAACTCAGGTTGAAGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020703.1-1400s1c1
Sequence:CCGGGACACTGTCTGTGGAATTGAACTCGAGTTCAATTCCACAGACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020703
AMIGO1 MISSION shRNA shRNA Plasmid DNA
adhesion molecule with Ig-like domain 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-1275s1c1
Sequence:CCGGGTGCTAGATGAGGTGACCAATCTCGAGATTGGTCACCTCATCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020703.1-2088s1c1
Sequence:CCGGGAAGAGAAGCATGTCTGAGTTCTCGAGAACTCAGACATGCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-767s1c1
Sequence:CCGGGCTGCTCTACAATAACCACATCTCGAGATGTGGTTATTGTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-833s1c1
Sequence:CCGGGAAACTCTACTTGAGCCAGAACTCGAGTTCTGGCTCAAGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-1130s1c1
Sequence:CCGGCAATGTCTTCAACCTGAGTTTCTCGAGAAACTCAGGTTGAAGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020703.1-1400s1c1
Sequence:CCGGGACACTGTCTGTGGAATTGAACTCGAGTTCAATTCCACAGACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020703
AMIGO1 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule with Ig-like domain 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-1275s1c1
Sequence:CCGGGTGCTAGATGAGGTGACCAATCTCGAGATTGGTCACCTCATCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020703.1-2088s1c1
Sequence:CCGGGAAGAGAAGCATGTCTGAGTTCTCGAGAACTCAGACATGCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-767s1c1
Sequence:CCGGGCTGCTCTACAATAACCACATCTCGAGATGTGGTTATTGTAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-833s1c1
Sequence:CCGGGAAACTCTACTTGAGCCAGAACTCGAGTTCTGGCTCAAGTAGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020703.1-1130s1c1
Sequence:CCGGCAATGTCTTCAACCTGAGTTTCTCGAGAAACTCAGGTTGAAGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020703.1-1400s1c1
Sequence:CCGGGACACTGTCTGTGGAATTGAACTCGAGTTCAATTCCACAGACAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146137
AMIGO1 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule with Ig-like domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146137.2-4449s1c1
Sequence:CCGGCCCTACTACATCCACTAACTTCTCGAGAAGTTAGTGGATGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-978s1c1
Sequence:CCGGGATGGGAACAAATTACCCAAACTCGAGTTTGGGTAATTTGTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-849s1c1
Sequence:CCGGGAAGTGCTGTTGCTCTACAATCTCGAGATTGTAGAGCAACAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-1681s1c1
Sequence:CCGGGCTCTTCTATGCTCAGTACCACTCGAGTGGTACTGAGCATAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-1396s1c1
Sequence:CCGGGCGTGAGGAATGGCGACCTTTCTCGAGAAAGGTCGCCATTCCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146137
AMIGO1 MISSION shRNA shRNA Plasmid DNA
adhesion molecule with Ig-like domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146137.2-4449s1c1
Sequence:CCGGCCCTACTACATCCACTAACTTCTCGAGAAGTTAGTGGATGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-978s1c1
Sequence:CCGGGATGGGAACAAATTACCCAAACTCGAGTTTGGGTAATTTGTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-849s1c1
Sequence:CCGGGAAGTGCTGTTGCTCTACAATCTCGAGATTGTAGAGCAACAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-1681s1c1
Sequence:CCGGGCTCTTCTATGCTCAGTACCACTCGAGTGGTACTGAGCATAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-1396s1c1
Sequence:CCGGGCGTGAGGAATGGCGACCTTTCTCGAGAAAGGTCGCCATTCCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146137
AMIGO1 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule with Ig-like domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146137.2-4449s1c1
Sequence:CCGGCCCTACTACATCCACTAACTTCTCGAGAAGTTAGTGGATGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-978s1c1
Sequence:CCGGGATGGGAACAAATTACCCAAACTCGAGTTTGGGTAATTTGTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-849s1c1
Sequence:CCGGGAAGTGCTGTTGCTCTACAATCTCGAGATTGTAGAGCAACAGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-1681s1c1
Sequence:CCGGGCTCTTCTATGCTCAGTACCACTCGAGTGGTACTGAGCATAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146137.2-1396s1c1
Sequence:CCGGGCGTGAGGAATGGCGACCTTTCTCGAGAAAGGTCGCCATTCCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks