EMAIL THIS PAGE TO A FRIEND

AMIGO2

adhesion molecule with Ig-like domain 2

86 Gene Product Result for
Synonyms: ALI1 AMIGO-2 DEGA
UniProtKB ID: Q86SJ2, Q4VBP6, Q7Z4A0, Q96CN8
Gene ID:
Mouse(105827) adhesion molecule with Ig like domain 2
Rat(300186) adhesion molecule with Ig like domain 2
chicken(417810) adhesion molecule with Ig-like domain 2
cow(514273) adhesion molecule with Ig-like domain 2
Horse(100050463) adhesion molecule with Ig-like domain 2
domestic cat(101084295) adhesion molecule with Ig-like domain 2
dog(486594) adhesion molecule with Ig-like domain 2
sheep(101111179) adhesion molecule with Ig-like domain 2
domestic guinea pig(100713404) adhesion molecule with Ig-like domain 2
naked mole-rat(101717269) adhesion molecule with Ig-like domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1261 Human AmiGO2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181847 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181847 Rosetta Predictions human pricing
NM_182816 Rosetta Predictions rat pricing
NM_178114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130666 predicted 1541
2 SASI_Hs01_00130667 predicted 1496
3 SASI_Hs01_00130668 predicted 1401
4 SASI_Hs01_00130669 predicted 1374
5 SASI_Hs01_00130671 predicted 729
6 SASI_Hs01_00130672 predicted 1163
7 SASI_Hs02_00370445 predicted 827
8 SASI_Hs01_00130673 predicted 1085
9 SASI_Hs01_00130674 predicted 1008
10 SASI_Hs01_00130675 predicted 900
11 SASI_Hs01_00130670 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115246 predicted 757
2 SASI_Rn01_00115247 predicted 977
3 SASI_Rn01_00115248 predicted 1281
4 SASI_Rn01_00115249 predicted 1290
5 SASI_Rn01_00115250 predicted 1441
6 SASI_Rn01_00115251 predicted 2149
7 SASI_Rn01_00115252 predicted 1821
8 SASI_Rn02_00269841 predicted 861
9 SASI_Rn01_00115253 predicted 1063
10 SASI_Rn02_00269842 predicted 909
11 SASI_Rn01_00115245 predicted 1297
12 SASI_Rn01_00115254 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045512 predicted 651
2 SASI_Mm01_00045513 predicted 2042
3 SASI_Mm01_00045514 predicted 1009
4 SASI_Mm01_00045515 predicted 2187
5 SASI_Mm01_00045516 predicted 861
6 SASI_Mm01_00045518 predicted 1276
7 SASI_Mm01_00045519 predicted 805
8 SASI_Mm01_00045521 predicted 1654
9 SASI_Mm02_00348582 predicted 2118
10 SASI_Mm02_00348583 predicted 791
11 SASI_Mm01_00045517 predicted 1270
12 SASI_Mm01_00045520 predicted 1266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178114
VALIDATED
AMIGO2 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule with Ig-like domain 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-793s1c1
Sequence:CCGGGTCGGTAAAGAGTGCCACATTCTCGAGAATGTGGCACTCTTTACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-631s1c1
Sequence:CCGGCTATAACAGAATCGGACTGTTCTCGAGAACAGTCCGATTCTGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-1234s1c1
Sequence:CCGGGAGCTTTCTGAACTGTTCTTACTCGAGTAAGAACAGTTCAGAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-1243s1c1
Sequence:CCGGGAACTGTTCTTACAGCGTTATCTCGAGATAACGCTGTAAGAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178114.2-1025s1c1
Sequence:CCGGCCGATGCACCATATAAACTTACTCGAGTAAGTTTATATGGTGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1931s1c1
Sequence:CCGGGTGTTCTCAGACACACCCTTTCTCGAGAAAGGGTGTGTCTGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-841s1c1
Sequence:CCGGGCTGCTGTACAACAACCACATCTCGAGATGTGGTTGTTGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1625s1c1
Sequence:CCGGGCCAGTATAGTTCTAGTGCTACTCGAGTAGCACTAGAACTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1514s1c1
Sequence:CCGGCTGTTAAACGAGACGGTGGATCTCGAGATCCACCGTCTCGTTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-772s1c1
Sequence:CCGGCTTATCATCCAATAGGCTGAACTCGAGTTCAGCCTATTGGATGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178114
VALIDATED
AMIGO2 MISSION shRNA shRNA Plasmid DNA
adhesion molecule with Ig-like domain 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-793s1c1
Sequence:CCGGGTCGGTAAAGAGTGCCACATTCTCGAGAATGTGGCACTCTTTACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-631s1c1
Sequence:CCGGCTATAACAGAATCGGACTGTTCTCGAGAACAGTCCGATTCTGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-1234s1c1
Sequence:CCGGGAGCTTTCTGAACTGTTCTTACTCGAGTAAGAACAGTTCAGAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-1243s1c1
Sequence:CCGGGAACTGTTCTTACAGCGTTATCTCGAGATAACGCTGTAAGAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178114.2-1025s1c1
Sequence:CCGGCCGATGCACCATATAAACTTACTCGAGTAAGTTTATATGGTGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1931s1c1
Sequence:CCGGGTGTTCTCAGACACACCCTTTCTCGAGAAAGGGTGTGTCTGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-841s1c1
Sequence:CCGGGCTGCTGTACAACAACCACATCTCGAGATGTGGTTGTTGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1625s1c1
Sequence:CCGGGCCAGTATAGTTCTAGTGCTACTCGAGTAGCACTAGAACTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1514s1c1
Sequence:CCGGCTGTTAAACGAGACGGTGGATCTCGAGATCCACCGTCTCGTTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-772s1c1
Sequence:CCGGCTTATCATCCAATAGGCTGAACTCGAGTTCAGCCTATTGGATGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178114
VALIDATED
AMIGO2 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule with Ig-like domain 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-793s1c1
Sequence:CCGGGTCGGTAAAGAGTGCCACATTCTCGAGAATGTGGCACTCTTTACCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-631s1c1
Sequence:CCGGCTATAACAGAATCGGACTGTTCTCGAGAACAGTCCGATTCTGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-1234s1c1
Sequence:CCGGGAGCTTTCTGAACTGTTCTTACTCGAGTAAGAACAGTTCAGAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178114.2-1243s1c1
Sequence:CCGGGAACTGTTCTTACAGCGTTATCTCGAGATAACGCTGTAAGAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178114.2-1025s1c1
Sequence:CCGGCCGATGCACCATATAAACTTACTCGAGTAAGTTTATATGGTGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1931s1c1
Sequence:CCGGGTGTTCTCAGACACACCCTTTCTCGAGAAAGGGTGTGTCTGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-841s1c1
Sequence:CCGGGCTGCTGTACAACAACCACATCTCGAGATGTGGTTGTTGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1625s1c1
Sequence:CCGGGCCAGTATAGTTCTAGTGCTACTCGAGTAGCACTAGAACTATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-1514s1c1
Sequence:CCGGCTGTTAAACGAGACGGTGGATCTCGAGATCCACCGTCTCGTTTAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178114.2-772s1c1
Sequence:CCGGCTTATCATCCAATAGGCTGAACTCGAGTTCAGCCTATTGGATGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181847
VALIDATED
AMIGO2 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule with Ig-like domain 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181847.2-1085s1c1
Sequence:CCGGCCATGCCAATGCACCACATAACTCGAGTTATGTGGTGCATTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-1010s1c1
Sequence:CCGGCGATGGATTTGTATGTTGGAACTCGAGTTCCAACATACAAATCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181847.2-772s1c1
Sequence:CCGGCATAACAACATCACCAGCATTCTCGAGAATGCTGGTGATGTTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-2496s1c1
Sequence:CCGGGCCTAAAGCAAAGTTAGATTTCTCGAGAAATCTAACTTTGCTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-830s1c1
Sequence:CCGGGTCTTGACTTATCGTCCAATACTCGAGTATTGGACGATAAGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-2621s1c1
Sequence:CCGGGCAAGGAAAGTACATTTGTTTCTCGAGAAACAAATGTACTTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-1616s1c1
Sequence:CCGGGCAATTTCACTGTAAGCAGATCTCGAGATCTGCTTACAGTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181847.2-1009s1c1
Sequence:CCGGCCGATGGATTTGTATGTTGGACTCGAGTCCAACATACAAATCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181847.2-1638s1c1
Sequence:CCGGCCATGCTCATGAGGCATTTAACTCGAGTTAAATGCCTCATGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-915s21c1
Sequence:CCGGGTCTTGACTTATCGTCCAATACTCGAGTATTGGACGATAAGTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1094s21c1
Sequence:CCGGCCGATGGATTTGTATGTTGGACTCGAGTCCAACATACAAATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1701s21c1
Sequence:CCGGGCAATTTCACTGTAAGCAGATCTCGAGATCTGCTTACAGTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1723s21c1
Sequence:CCGGCCATGCTCATGAGGCATTTAACTCGAGTTAAATGCCTCATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181847
VALIDATED
AMIGO2 MISSION shRNA shRNA Plasmid DNA
adhesion molecule with Ig-like domain 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181847.2-1085s1c1
Sequence:CCGGCCATGCCAATGCACCACATAACTCGAGTTATGTGGTGCATTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-1010s1c1
Sequence:CCGGCGATGGATTTGTATGTTGGAACTCGAGTTCCAACATACAAATCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181847.2-772s1c1
Sequence:CCGGCATAACAACATCACCAGCATTCTCGAGAATGCTGGTGATGTTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-2496s1c1
Sequence:CCGGGCCTAAAGCAAAGTTAGATTTCTCGAGAAATCTAACTTTGCTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-830s1c1
Sequence:CCGGGTCTTGACTTATCGTCCAATACTCGAGTATTGGACGATAAGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-2621s1c1
Sequence:CCGGGCAAGGAAAGTACATTTGTTTCTCGAGAAACAAATGTACTTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-1616s1c1
Sequence:CCGGGCAATTTCACTGTAAGCAGATCTCGAGATCTGCTTACAGTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181847.2-1009s1c1
Sequence:CCGGCCGATGGATTTGTATGTTGGACTCGAGTCCAACATACAAATCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181847.2-1638s1c1
Sequence:CCGGCCATGCTCATGAGGCATTTAACTCGAGTTAAATGCCTCATGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-915s21c1
Sequence:CCGGGTCTTGACTTATCGTCCAATACTCGAGTATTGGACGATAAGTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1094s21c1
Sequence:CCGGCCGATGGATTTGTATGTTGGACTCGAGTCCAACATACAAATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1701s21c1
Sequence:CCGGGCAATTTCACTGTAAGCAGATCTCGAGATCTGCTTACAGTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1723s21c1
Sequence:CCGGCCATGCTCATGAGGCATTTAACTCGAGTTAAATGCCTCATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181847
VALIDATED
AMIGO2 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule with Ig-like domain 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181847.2-1085s1c1
Sequence:CCGGCCATGCCAATGCACCACATAACTCGAGTTATGTGGTGCATTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-1010s1c1
Sequence:CCGGCGATGGATTTGTATGTTGGAACTCGAGTTCCAACATACAAATCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181847.2-772s1c1
Sequence:CCGGCATAACAACATCACCAGCATTCTCGAGAATGCTGGTGATGTTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-2496s1c1
Sequence:CCGGGCCTAAAGCAAAGTTAGATTTCTCGAGAAATCTAACTTTGCTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-830s1c1
Sequence:CCGGGTCTTGACTTATCGTCCAATACTCGAGTATTGGACGATAAGTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-2621s1c1
Sequence:CCGGGCAAGGAAAGTACATTTGTTTCTCGAGAAACAAATGTACTTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_181847.2-1616s1c1
Sequence:CCGGGCAATTTCACTGTAAGCAGATCTCGAGATCTGCTTACAGTGAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181847.2-1009s1c1
Sequence:CCGGCCGATGGATTTGTATGTTGGACTCGAGTCCAACATACAAATCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_181847.2-1638s1c1
Sequence:CCGGCCATGCTCATGAGGCATTTAACTCGAGTTAAATGCCTCATGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-915s21c1
Sequence:CCGGGTCTTGACTTATCGTCCAATACTCGAGTATTGGACGATAAGTCAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1094s21c1
Sequence:CCGGCCGATGGATTTGTATGTTGGACTCGAGTCCAACATACAAATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1701s21c1
Sequence:CCGGGCAATTTCACTGTAAGCAGATCTCGAGATCTGCTTACAGTGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181847.4-1723s21c1
Sequence:CCGGCCATGCTCATGAGGCATTTAACTCGAGTTAAATGCCTCATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks