EMAIL THIS PAGE TO A FRIEND

AMIGO3

adhesion molecule with Ig-like domain 3

51 Gene Product Result for
Synonyms: AMIGO-3
UniProtKB ID: Q86WK7, Q494V6, Q96JH6
Gene ID:
Mouse(320844) adhesion molecule with Ig like domain 3
Rat(316003) adhesion molecule with Ig like domain 3
naked mole-rat(101717098) adhesion molecule with Ig-like domain 3
domestic guinea pig(100735219) adhesion molecule with Ig-like domain 3
Zebrafish(100000131) adhesion molecule with Ig-like domain 3
chicken(101668562) adhesion molecule with Ig-like domain 3
dog(484766) adhesion molecule with Ig-like domain 3
cow(100296605) adhesion molecule with Ig-like domain 3
chicken(101748940) adhesion molecule with Ig-like domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198722 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198722 Rosetta Predictions human pricing
NM_178144 Rosetta Predictions rat pricing
NM_177275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141241 predicted 1855
2 SASI_Hs01_00141242 predicted 562
3 SASI_Hs01_00141243 predicted 708
4 SASI_Hs01_00141244 predicted 855
5 SASI_Hs01_00141246 predicted 717
6 SASI_Hs01_00141247 predicted 956
7 SASI_Hs01_00141248 predicted 622
8 SASI_Hs01_00141249 predicted 1873
9 SASI_Hs01_00141250 predicted 495
10 SASI_Hs02_00372320 predicted 1153
11 SASI_Hs01_00141245 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100752 predicted 632
2 SASI_Rn02_00269637 predicted 725
3 SASI_Rn01_00100753 predicted 352
4 SASI_Rn01_00100754 predicted 405
5 SASI_Rn01_00100757 predicted 357
6 SASI_Rn01_00100758 predicted 258
7 SASI_Rn02_00269638 predicted 843
8 SASI_Rn01_00100759 predicted 484
9 SASI_Rn01_00100760 predicted 495
10 SASI_Rn01_00100761 predicted 324
11 SASI_Rn01_00100755 predicted 556
12 SASI_Rn01_00100756 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143675 predicted 563
2 SASI_Mm01_00143676 predicted 236
3 SASI_Mm01_00143677 predicted 957
4 SASI_Mm01_00143678 predicted 964
5 SASI_Mm01_00143679 predicted 1155
6 SASI_Mm01_00143680 predicted 1836
7 SASI_Mm01_00143681 predicted 413
8 SASI_Mm01_00143683 predicted 231
9 SASI_Mm02_00347325 predicted 1316
10 SASI_Mm02_00347326 predicted 962
11 SASI_Mm01_00143674 predicted 632
12 SASI_Mm01_00143682 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177275
AMIGO3 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule with Ig-like domain 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177275.4-404s21c1
Sequence:CCGGCACTGCTGCAGAACTCGATTTCTCGAGAAATCGAGTTCTGCAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177275.4-2025s21c1
Sequence:CCGGAGATGTCAGGGTGTGGTATAGCTCGAGCTATACCACACCCTGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-1411s1c1
Sequence:CCGGCTGGTGTTGCTCTACTTGTTTCTCGAGAAACAAGTAGAGCAACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-1357s1c1
Sequence:CCGGGAGACTTTCAACACAGGCTTTCTCGAGAAAGCCTGTGTTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-963s1c1
Sequence:CCGGCGAGTACACATGCTTGGTCTTCTCGAGAAGACCAAGCATGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177275.2-1947s1c1
Sequence:CCGGCCCATTAACATTACAGACTAACTCGAGTTAGTCTGTAATGTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-496s1c1
Sequence:CCGGCTAGGCTATAATAAGCTGGAACTCGAGTTCCAGCTTATTATAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177275
AMIGO3 MISSION shRNA shRNA Plasmid DNA
adhesion molecule with Ig-like domain 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177275.4-404s21c1
Sequence:CCGGCACTGCTGCAGAACTCGATTTCTCGAGAAATCGAGTTCTGCAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177275.4-2025s21c1
Sequence:CCGGAGATGTCAGGGTGTGGTATAGCTCGAGCTATACCACACCCTGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-1411s1c1
Sequence:CCGGCTGGTGTTGCTCTACTTGTTTCTCGAGAAACAAGTAGAGCAACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-1357s1c1
Sequence:CCGGGAGACTTTCAACACAGGCTTTCTCGAGAAAGCCTGTGTTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-963s1c1
Sequence:CCGGCGAGTACACATGCTTGGTCTTCTCGAGAAGACCAAGCATGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177275.2-1947s1c1
Sequence:CCGGCCCATTAACATTACAGACTAACTCGAGTTAGTCTGTAATGTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-496s1c1
Sequence:CCGGCTAGGCTATAATAAGCTGGAACTCGAGTTCCAGCTTATTATAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177275
AMIGO3 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule with Ig-like domain 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177275.4-404s21c1
Sequence:CCGGCACTGCTGCAGAACTCGATTTCTCGAGAAATCGAGTTCTGCAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177275.4-2025s21c1
Sequence:CCGGAGATGTCAGGGTGTGGTATAGCTCGAGCTATACCACACCCTGACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-1411s1c1
Sequence:CCGGCTGGTGTTGCTCTACTTGTTTCTCGAGAAACAAGTAGAGCAACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-1357s1c1
Sequence:CCGGGAGACTTTCAACACAGGCTTTCTCGAGAAAGCCTGTGTTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-963s1c1
Sequence:CCGGCGAGTACACATGCTTGGTCTTCTCGAGAAGACCAAGCATGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177275.2-1947s1c1
Sequence:CCGGCCCATTAACATTACAGACTAACTCGAGTTAGTCTGTAATGTTAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177275.2-496s1c1
Sequence:CCGGCTAGGCTATAATAAGCTGGAACTCGAGTTCCAGCTTATTATAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198722
AMIGO3 MISSION shRNA Bacterial Glycerol Stock
adhesion molecule with Ig-like domain 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-969s1c1
Sequence:CCGGGTACGTATGCTTGGCCTTCAACTCGAGTTGAAGGCCAAGCATACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198722.1-2002s1c1
Sequence:CCGGCGGACTTCCTAGTGCCCAAATCTCGAGATTTGGGCACTAGGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-867s1c1
Sequence:CCGGCTACTTGCACAACAACCCTTTCTCGAGAAAGGGTTGTTGTGCAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-631s1c1
Sequence:CCGGGAGAAGCTGCTTCTGTTCAATCTCGAGATTGAACAGAAGCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-1578s1c1
Sequence:CCGGCAAGCACGTAGTCTTTCTGGACTCGAGTCCAGAAAGACTACGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-648s1c1
Sequence:CCGGCAATAACCGCTTGGTGCACTTCTCGAGAAGTGCACCAAGCGGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-865s1c1
Sequence:CCGGCTCTACTTGCACAACAACCCTCTCGAGAGGGTTGTTGTGCAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-328s1c1
Sequence:CCGGCCCTACAAATGTATCTGCGCTCTCGAGAGCGCAGATACATTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-639s1c1
Sequence:CCGGGCTTCTGTTCAATAACCGCTTCTCGAGAAGCGGTTATTGAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-633s1c1
Sequence:CCGGGAAGCTGCTTCTGTTCAATAACTCGAGTTATTGAACAGAAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198722
AMIGO3 MISSION shRNA shRNA Plasmid DNA
adhesion molecule with Ig-like domain 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-969s1c1
Sequence:CCGGGTACGTATGCTTGGCCTTCAACTCGAGTTGAAGGCCAAGCATACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198722.1-2002s1c1
Sequence:CCGGCGGACTTCCTAGTGCCCAAATCTCGAGATTTGGGCACTAGGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-867s1c1
Sequence:CCGGCTACTTGCACAACAACCCTTTCTCGAGAAAGGGTTGTTGTGCAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-631s1c1
Sequence:CCGGGAGAAGCTGCTTCTGTTCAATCTCGAGATTGAACAGAAGCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-1578s1c1
Sequence:CCGGCAAGCACGTAGTCTTTCTGGACTCGAGTCCAGAAAGACTACGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-648s1c1
Sequence:CCGGCAATAACCGCTTGGTGCACTTCTCGAGAAGTGCACCAAGCGGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-865s1c1
Sequence:CCGGCTCTACTTGCACAACAACCCTCTCGAGAGGGTTGTTGTGCAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-328s1c1
Sequence:CCGGCCCTACAAATGTATCTGCGCTCTCGAGAGCGCAGATACATTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-639s1c1
Sequence:CCGGGCTTCTGTTCAATAACCGCTTCTCGAGAAGCGGTTATTGAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-633s1c1
Sequence:CCGGGAAGCTGCTTCTGTTCAATAACTCGAGTTATTGAACAGAAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198722
AMIGO3 MISSION shRNA Lentiviral Transduction Particles
adhesion molecule with Ig-like domain 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-969s1c1
Sequence:CCGGGTACGTATGCTTGGCCTTCAACTCGAGTTGAAGGCCAAGCATACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198722.1-2002s1c1
Sequence:CCGGCGGACTTCCTAGTGCCCAAATCTCGAGATTTGGGCACTAGGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-867s1c1
Sequence:CCGGCTACTTGCACAACAACCCTTTCTCGAGAAAGGGTTGTTGTGCAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-631s1c1
Sequence:CCGGGAGAAGCTGCTTCTGTTCAATCTCGAGATTGAACAGAAGCAGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-1578s1c1
Sequence:CCGGCAAGCACGTAGTCTTTCTGGACTCGAGTCCAGAAAGACTACGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-648s1c1
Sequence:CCGGCAATAACCGCTTGGTGCACTTCTCGAGAAGTGCACCAAGCGGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-865s1c1
Sequence:CCGGCTCTACTTGCACAACAACCCTCTCGAGAGGGTTGTTGTGCAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-328s1c1
Sequence:CCGGCCCTACAAATGTATCTGCGCTCTCGAGAGCGCAGATACATTTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198722.1-639s1c1
Sequence:CCGGGCTTCTGTTCAATAACCGCTTCTCGAGAAGCGGTTATTGAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198722.1-633s1c1
Sequence:CCGGGAAGCTGCTTCTGTTCAATAACTCGAGTTATTGAACAGAAGCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks