EMAIL THIS PAGE TO A FRIEND

AMMECR1

Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1

272 Gene Product Result for
Synonyms: AMMERC1
UniProtKB ID: Q9Y4X0, Q5JYV9, Q6P9D8, Q8WX22, Q9UIQ8
Gene ID:
Human(9949) Summary: The exact function of this gene is not known, however, submicroscopic deletion of the X chromosome including this gene, COL4A5, and FACL4 genes, result in a contiguous gene deletion syndrome, the AMME complex (Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Mouse(56068) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Rat(501539) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Zebrafish(393553) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 homolog (human)
dog(492063) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
cow(615842) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
chicken(422343) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
sheep(101113829) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
domestic guinea pig(100721876) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
naked mole-rat(101715875) Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015365 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002591 MISSION® esiRNA esiRNA targeting human AMMECR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025580 Rosetta Predictions human pricing
NM_015365 Rosetta Predictions human pricing
XM_001057408 Rosetta Predictions rat pricing
XM_576941 Rosetta Predictions rat pricing
NM_019496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091797 predicted 796
2 SASI_Hs01_00091798 predicted 546
3 SASI_Hs01_00091799 predicted 1101
4 SASI_Hs01_00091801 predicted 667
5 SASI_Hs02_00307467 predicted 614
6 SASI_Hs01_00091802 predicted 1105
7 SASI_Hs02_00307468 predicted 1025
8 SASI_Hs01_00091803 predicted 1097
9 SASI_Hs01_00091804 predicted 550
10 SASI_Hs01_00091805 predicted 1023
11 SASI_Hs01_00091800 predicted 586
12 SASI_Hs01_00091806 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145109 predicted 909
2 SASI_Hs01_00145110 predicted 644
3 SASI_Hs01_00145111 predicted 565
4 SASI_Hs01_00145112 predicted 1219
5 SASI_Hs02_00347702 predicted 745
6 SASI_Hs01_00145113 predicted 1207
7 SASI_Hs01_00145114 predicted 1538
8 SASI_Hs01_00145115 predicted 1491
9 SASI_Hs01_00145116 predicted 783
10 SASI_Hs01_00145117 predicted 753
11 SASI_Hs01_00145118 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286235 predicted 667
2 SASI_Rn02_00286236 predicted 934
3 SASI_Rn02_00286237 predicted 455
4 SASI_Rn02_00286238 predicted 369
5 SASI_Rn02_00286239 predicted 676
6 SASI_Rn02_00286240 predicted 637
7 SASI_Rn02_00286241 predicted 261
8 SASI_Rn02_00286242 predicted 540
9 SASI_Rn02_00286243 predicted 717
10 SASI_Rn02_00286244 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129576 predicted 1302
2 SASI_Rn01_00129577 predicted 1297
3 SASI_Rn01_00129578 predicted 1304
4 SASI_Rn01_00129579 predicted 1640
5 SASI_Rn01_00129580 predicted 1660
6 SASI_Rn01_00129581 predicted 1053
7 SASI_Rn01_00129582 predicted 735
8 SASI_Rn01_00129583 predicted 1728
9 SASI_Rn01_00129584 predicted 1010
10 SASI_Rn01_00129585 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069532 predicted 881
2 SASI_Mm01_00069533 predicted 828
3 SASI_Mm01_00069534 predicted 615
4 SASI_Mm01_00069535 predicted 857
5 SASI_Mm01_00069536 predicted 529
6 SASI_Mm01_00069537 predicted 838
7 SASI_Mm01_00069538 predicted 808
8 SASI_Mm01_00069539 predicted 889
9 SASI_Mm01_00069540 predicted 726
10 SASI_Mm01_00069541 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019496
AMMECR1 MISSION shRNA Bacterial Glycerol Stock
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019496.2-1728s1c1
Sequence:CCGGGCCTCATGTTATAGAACAATTCTCGAGAATTGTTCTATAACATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-716s21c1
Sequence:CCGGTTGAAGATGTTTGCGACTATTCTCGAGAATAGTCGCAAACATCTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-623s21c1
Sequence:CCGGCACTTACCAGTGCCCTTAAAGCTCGAGCTTTAAGGGCACTGGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019496.3-2570s21c1
Sequence:CCGGACTATGACATACCGCTAATTACTCGAGTAATTAGCGGTATGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-1026s21c1
Sequence:CCGGTCCGCCATACAACCATTATTCCTCGAGGAATAATGGTTGTATGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-833s21c1
Sequence:CCGGAGCAAGGATGGGACCATATTCCTCGAGGAATATGGTCCCATCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019496
AMMECR1 MISSION shRNA shRNA Plasmid DNA
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019496.2-1728s1c1
Sequence:CCGGGCCTCATGTTATAGAACAATTCTCGAGAATTGTTCTATAACATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-716s21c1
Sequence:CCGGTTGAAGATGTTTGCGACTATTCTCGAGAATAGTCGCAAACATCTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-623s21c1
Sequence:CCGGCACTTACCAGTGCCCTTAAAGCTCGAGCTTTAAGGGCACTGGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019496.3-2570s21c1
Sequence:CCGGACTATGACATACCGCTAATTACTCGAGTAATTAGCGGTATGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-1026s21c1
Sequence:CCGGTCCGCCATACAACCATTATTCCTCGAGGAATAATGGTTGTATGGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-833s21c1
Sequence:CCGGAGCAAGGATGGGACCATATTCCTCGAGGAATATGGTCCCATCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019496
AMMECR1 MISSION shRNA Lentiviral Transduction Particles
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019496.2-1728s1c1
Sequence:CCGGGCCTCATGTTATAGAACAATTCTCGAGAATTGTTCTATAACATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-716s21c1
Sequence:CCGGTTGAAGATGTTTGCGACTATTCTCGAGAATAGTCGCAAACATCTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-623s21c1
Sequence:CCGGCACTTACCAGTGCCCTTAAAGCTCGAGCTTTAAGGGCACTGGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019496.3-2570s21c1
Sequence:CCGGACTATGACATACCGCTAATTACTCGAGTAATTAGCGGTATGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-1026s21c1
Sequence:CCGGTCCGCCATACAACCATTATTCCTCGAGGAATAATGGTTGTATGGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019496.3-833s21c1
Sequence:CCGGAGCAAGGATGGGACCATATTCCTCGAGGAATATGGTCCCATCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015365
VALIDATED
AMMECR1 MISSION shRNA Bacterial Glycerol Stock
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015365.1-1001s1c1
Sequence:CCGGGAGGATACAAAGCTCCGATTACTCGAGTAATCGGAGCTTTGTATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-752s1c1
Sequence:CCGGGTGCCCTTAAAGATAGCCGTTCTCGAGAACGGCTATCTTTAAGGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-999s1c1
Sequence:CCGGAGGAGGATACAAAGCTCCGATCTCGAGATCGGAGCTTTGTATCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-1143s1c1
Sequence:CCGGCCTTCCGCCATACAACCATTACTCGAGTAATGGTTGTATGGCGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015365.1-823s1c1
Sequence:CCGGCTGCTCACTAACTTTGAAGATCTCGAGATCTTCAAAGTTAGTGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015365.2-784s21c1
Sequence:CCGGGGTGTACATGGCATTAGAATACTCGAGTATTCTAATGCCATGTACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015365.2-1212s21c1
Sequence:CCGGGCTTCGACATCGTCAACTAAGCTCGAGCTTAGTTGACGATGTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015365.2-877s21c1
Sequence:CCGGGACCATATACAGACCATAGACCTCGAGGTCTATGGTCTGTATATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015365
VALIDATED
AMMECR1 MISSION shRNA shRNA Plasmid DNA
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015365.1-1001s1c1
Sequence:CCGGGAGGATACAAAGCTCCGATTACTCGAGTAATCGGAGCTTTGTATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-752s1c1
Sequence:CCGGGTGCCCTTAAAGATAGCCGTTCTCGAGAACGGCTATCTTTAAGGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-999s1c1
Sequence:CCGGAGGAGGATACAAAGCTCCGATCTCGAGATCGGAGCTTTGTATCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-1143s1c1
Sequence:CCGGCCTTCCGCCATACAACCATTACTCGAGTAATGGTTGTATGGCGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015365.1-823s1c1
Sequence:CCGGCTGCTCACTAACTTTGAAGATCTCGAGATCTTCAAAGTTAGTGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015365.2-784s21c1
Sequence:CCGGGGTGTACATGGCATTAGAATACTCGAGTATTCTAATGCCATGTACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015365.2-1212s21c1
Sequence:CCGGGCTTCGACATCGTCAACTAAGCTCGAGCTTAGTTGACGATGTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015365.2-877s21c1
Sequence:CCGGGACCATATACAGACCATAGACCTCGAGGTCTATGGTCTGTATATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015365
VALIDATED
AMMECR1 MISSION shRNA Lentiviral Transduction Particles
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015365.1-1001s1c1
Sequence:CCGGGAGGATACAAAGCTCCGATTACTCGAGTAATCGGAGCTTTGTATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-752s1c1
Sequence:CCGGGTGCCCTTAAAGATAGCCGTTCTCGAGAACGGCTATCTTTAAGGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-999s1c1
Sequence:CCGGAGGAGGATACAAAGCTCCGATCTCGAGATCGGAGCTTTGTATCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015365.1-1143s1c1
Sequence:CCGGCCTTCCGCCATACAACCATTACTCGAGTAATGGTTGTATGGCGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_015365.1-823s1c1
Sequence:CCGGCTGCTCACTAACTTTGAAGATCTCGAGATCTTCAAAGTTAGTGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015365.2-784s21c1
Sequence:CCGGGGTGTACATGGCATTAGAATACTCGAGTATTCTAATGCCATGTACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015365.2-1212s21c1
Sequence:CCGGGCTTCGACATCGTCAACTAAGCTCGAGCTTAGTTGACGATGTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015365.2-877s21c1
Sequence:CCGGGACCATATACAGACCATAGACCTCGAGGTCTATGGTCTGTATATGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)