EMAIL THIS PAGE TO A FRIEND

AMMECR1L

AMMECR1-like

282 Gene Product Result for
UniProtKB ID: Q6DCA0, B4E276
Gene ID:
Mouse(225339) AMME chromosomal region gene 1-like
Rat(307526) AMME chromosomal region gene 1-like
chicken(424755) AMME chromosomal region gene 1-like
cow(539958) AMME chromosomal region gene 1-like
Horse(100067484) AMME chromosomal region gene 1-like
domestic cat(101092451) AMME chromosomal region gene 1-like
dog(483862) AMME chromosomal region gene 1-like
sheep(101107573) AMMECR1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031445 Rosetta Predictions human pricing
NM_001107399 Rosetta Predictions rat pricing
NM_153515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119317 predicted 1049
2 SASI_Hs01_00119318 predicted 1269
3 SASI_Hs02_00358855 predicted 745
4 SASI_Hs01_00119319 predicted 591
5 SASI_Hs01_00119320 predicted 1084
6 SASI_Hs01_00119321 predicted 1028
7 SASI_Hs01_00119322 predicted 1021
8 SASI_Hs01_00119323 predicted 937
9 SASI_Hs01_00119324 predicted 427
10 SASI_Hs01_00119326 predicted 863
11 SASI_Hs01_00119325 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228435 predicted 580
2 SASI_Rn02_00228436 predicted 1044
3 SASI_Rn02_00228437 predicted 317
4 SASI_Rn02_00228438 predicted 1281
5 SASI_Rn02_00228439 predicted 1067
6 SASI_Rn02_00228440 predicted 1098
7 SASI_Rn02_00228441 predicted 573
8 SASI_Rn02_00228442 predicted 1088
9 SASI_Rn02_00228443 predicted 1389
10 SASI_Rn02_00228444 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096288 predicted 1241
2 SASI_Mm01_00096289 predicted 1480
3 SASI_Mm01_00096290 predicted 1263
4 SASI_Mm01_00096291 predicted 515
5 SASI_Mm01_00096292 predicted 681
6 SASI_Mm01_00096293 predicted 1302
7 SASI_Mm01_00096294 predicted 534
8 SASI_Mm01_00096295 predicted 1286
9 SASI_Mm01_00096296 predicted 1309
10 SASI_Mm02_00343275 predicted 1339
11 SASI_Mm01_00096287 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031445
VALIDATED
AMMECR1L MISSION shRNA Bacterial Glycerol Stock
AMMECR1-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-433s21c1
Sequence:CCGGGGGAGAATGTGTCAGACTTAACTCGAGTTAAGTCTGACACATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-931s21c1
Sequence:CCGGTCAAACGCACAGCCACATATTCTCGAGAATATGTGGCTGTGCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031445.2-1569s21c1
Sequence:CCGGCCCAGATGAAGTAGGTGTATTCTCGAGAATACACCTACTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-1095s21c1
Sequence:CCGGATCAGTTACGCAGAGTATATTCTCGAGAATATACTCTGCGTAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-746s21c1
Sequence:CCGGACTCAGGGAATACACGTTAACCTCGAGGTTAACGTGTATTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-889s21c1
Sequence:CCGGGGGTCCATGGGATTCGAATTGCTCGAGCAATTCGAATCCCATGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031445.2-851s21c1
Sequence:CCGGCTTTGAGGATGCCAGTGATTACTCGAGTAATCACTGGCATCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031445.2-1668s21c1
Sequence:CCGGTTGCGTACCAAGAGTTGATTACTCGAGTAATCAACTCTTGGTACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-745s1c1
Sequence:CCGGGACTCAGGGAATACACGTTAACTCGAGTTAACGTGTATTCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-963s1c1
Sequence:CCGGGCTAAGGAACAAGACTGGGATCTCGAGATCCCAGTCTTGTTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-1091s1c1
Sequence:CCGGGACAATCAGTTACGCAGAGTACTCGAGTACTCTGCGTAACTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031445.2-3494s1c1
Sequence:CCGGGCACAAGAATTGGGCTGGTTACTCGAGTAACCAGCCCAATTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031445
VALIDATED
AMMECR1L MISSION shRNA shRNA Plasmid DNA
AMMECR1-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-433s21c1
Sequence:CCGGGGGAGAATGTGTCAGACTTAACTCGAGTTAAGTCTGACACATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-931s21c1
Sequence:CCGGTCAAACGCACAGCCACATATTCTCGAGAATATGTGGCTGTGCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031445.2-1569s21c1
Sequence:CCGGCCCAGATGAAGTAGGTGTATTCTCGAGAATACACCTACTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-1095s21c1
Sequence:CCGGATCAGTTACGCAGAGTATATTCTCGAGAATATACTCTGCGTAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-746s21c1
Sequence:CCGGACTCAGGGAATACACGTTAACCTCGAGGTTAACGTGTATTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-889s21c1
Sequence:CCGGGGGTCCATGGGATTCGAATTGCTCGAGCAATTCGAATCCCATGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031445.2-851s21c1
Sequence:CCGGCTTTGAGGATGCCAGTGATTACTCGAGTAATCACTGGCATCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031445.2-1668s21c1
Sequence:CCGGTTGCGTACCAAGAGTTGATTACTCGAGTAATCAACTCTTGGTACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-745s1c1
Sequence:CCGGGACTCAGGGAATACACGTTAACTCGAGTTAACGTGTATTCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-963s1c1
Sequence:CCGGGCTAAGGAACAAGACTGGGATCTCGAGATCCCAGTCTTGTTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-1091s1c1
Sequence:CCGGGACAATCAGTTACGCAGAGTACTCGAGTACTCTGCGTAACTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031445.2-3494s1c1
Sequence:CCGGGCACAAGAATTGGGCTGGTTACTCGAGTAACCAGCCCAATTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031445
VALIDATED
AMMECR1L MISSION shRNA Lentiviral Transduction Particles
AMMECR1-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-433s21c1
Sequence:CCGGGGGAGAATGTGTCAGACTTAACTCGAGTTAAGTCTGACACATTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-931s21c1
Sequence:CCGGTCAAACGCACAGCCACATATTCTCGAGAATATGTGGCTGTGCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031445.2-1569s21c1
Sequence:CCGGCCCAGATGAAGTAGGTGTATTCTCGAGAATACACCTACTTCATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-1095s21c1
Sequence:CCGGATCAGTTACGCAGAGTATATTCTCGAGAATATACTCTGCGTAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-746s21c1
Sequence:CCGGACTCAGGGAATACACGTTAACCTCGAGGTTAACGTGTATTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031445.2-889s21c1
Sequence:CCGGGGGTCCATGGGATTCGAATTGCTCGAGCAATTCGAATCCCATGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031445.2-851s21c1
Sequence:CCGGCTTTGAGGATGCCAGTGATTACTCGAGTAATCACTGGCATCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031445.2-1668s21c1
Sequence:CCGGTTGCGTACCAAGAGTTGATTACTCGAGTAATCAACTCTTGGTACGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-745s1c1
Sequence:CCGGGACTCAGGGAATACACGTTAACTCGAGTTAACGTGTATTCCCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-963s1c1
Sequence:CCGGGCTAAGGAACAAGACTGGGATCTCGAGATCCCAGTCTTGTTCCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031445.2-1091s1c1
Sequence:CCGGGACAATCAGTTACGCAGAGTACTCGAGTACTCTGCGTAACTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031445.2-3494s1c1
Sequence:CCGGGCACAAGAATTGGGCTGGTTACTCGAGTAACCAGCCCAATTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153515
AMMECR1L MISSION shRNA Bacterial Glycerol Stock
AMMECR1-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1308s21c1
Sequence:CCGGATCAGTTATGCAGAGTATATTCTCGAGAATATACTCTGCATAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153515.3-1694s21c1
Sequence:CCGGGGTGATTTCCCACAAGTATTGCTCGAGCAATACTTGTGGGAAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1145s21c1
Sequence:CCGGCAAACGCACAGCCACATATTTCTCGAGAAATATGTGGCTGTGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1196s21c1
Sequence:CCGGTCAGATCCAGACAATAGATTCCTCGAGGAATCTATTGTCTGGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-744s21c1
Sequence:CCGGGGAACTGCCAATAGCACTAAGCTCGAGCTTAGTGCTATTGGCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153515.2-845s1c1
Sequence:CCGGGCTTCCTAGATTCACCAATGACTCGAGTCATTGGTGAATCTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153515.2-1304s1c1
Sequence:CCGGGACAATCAGTTATGCAGAGTACTCGAGTACTCTGCATAACTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153515.2-1779s1c1
Sequence:CCGGCCGCCACATCAATTAGCTGTACTCGAGTACAGCTAATTGATGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153515
AMMECR1L MISSION shRNA shRNA Plasmid DNA
AMMECR1-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1308s21c1
Sequence:CCGGATCAGTTATGCAGAGTATATTCTCGAGAATATACTCTGCATAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153515.3-1694s21c1
Sequence:CCGGGGTGATTTCCCACAAGTATTGCTCGAGCAATACTTGTGGGAAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1145s21c1
Sequence:CCGGCAAACGCACAGCCACATATTTCTCGAGAAATATGTGGCTGTGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1196s21c1
Sequence:CCGGTCAGATCCAGACAATAGATTCCTCGAGGAATCTATTGTCTGGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-744s21c1
Sequence:CCGGGGAACTGCCAATAGCACTAAGCTCGAGCTTAGTGCTATTGGCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153515.2-845s1c1
Sequence:CCGGGCTTCCTAGATTCACCAATGACTCGAGTCATTGGTGAATCTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153515.2-1304s1c1
Sequence:CCGGGACAATCAGTTATGCAGAGTACTCGAGTACTCTGCATAACTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153515.2-1779s1c1
Sequence:CCGGCCGCCACATCAATTAGCTGTACTCGAGTACAGCTAATTGATGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153515
AMMECR1L MISSION shRNA Lentiviral Transduction Particles
AMMECR1-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1308s21c1
Sequence:CCGGATCAGTTATGCAGAGTATATTCTCGAGAATATACTCTGCATAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153515.3-1694s21c1
Sequence:CCGGGGTGATTTCCCACAAGTATTGCTCGAGCAATACTTGTGGGAAATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1145s21c1
Sequence:CCGGCAAACGCACAGCCACATATTTCTCGAGAAATATGTGGCTGTGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-1196s21c1
Sequence:CCGGTCAGATCCAGACAATAGATTCCTCGAGGAATCTATTGTCTGGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153515.3-744s21c1
Sequence:CCGGGGAACTGCCAATAGCACTAAGCTCGAGCTTAGTGCTATTGGCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153515.2-845s1c1
Sequence:CCGGGCTTCCTAGATTCACCAATGACTCGAGTCATTGGTGAATCTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153515.2-1304s1c1
Sequence:CCGGGACAATCAGTTATGCAGAGTACTCGAGTACTCTGCATAACTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194387    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153515.2-1779s1c1
Sequence:CCGGCCGCCACATCAATTAGCTGTACTCGAGTACAGCTAATTGATGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks