EMAIL THIS PAGE TO A FRIEND

AMN1

antagonist of mitotic exit network 1 homolog (S. cerevisiae)

131 Gene Product Result for
UniProtKB ID: Q8IY45, Q6NVU4, Q86X98
Gene ID:
Mouse(232566) antagonist of mitotic exit network 1
Rat(302032) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
domestic guinea pig(100736192) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
sheep(101106760) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Zebrafish(751744) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
cow(524465) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
domestic cat(101093697) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
dog(489046) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
chicken(418137) antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001113424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001113424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001113424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_113708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_113708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_113708 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113402 Rosetta Predictions human pricing
NM_207337 Rosetta Predictions human pricing
NR_004854 Rosetta Predictions human pricing
NM_001008333 Rosetta Predictions rat pricing
NM_001113424 Rosetta Predictions mouse pricing
XM_132975 Rosetta Predictions mouse pricing
XM_894088 Rosetta Predictions mouse pricing
XM_901291 Rosetta Predictions mouse pricing
XM_921354 Rosetta Predictions mouse pricing
XM_921360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325811 predicted 1009
2 SASI_Hs02_00325812 predicted 754
3 SASI_Hs02_00325813 predicted 225
4 SASI_Hs02_00325814 predicted 616
5 SASI_Hs02_00325815 predicted 611
6 SASI_Hs02_00325816 predicted 634
7 SASI_Hs02_00325817 predicted 803
8 SASI_Hs02_00325818 predicted 915
9 SASI_Hs02_00325819 predicted 884
10 SASI_Hs02_00325820 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160293 predicted 876
2 SASI_Hs01_00160294 predicted 442
3 SASI_Hs01_00160295 predicted 474
4 SASI_Hs01_00160296 predicted 456
5 SASI_Hs01_00160297 predicted 495
6 SASI_Hs01_00160298 predicted 782
7 SASI_Hs01_00160299 predicted 812
8 SASI_Hs01_00160300 predicted 394
9 SASI_Hs01_00160301 predicted 221
10 SASI_Hs01_00160302 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_004854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381002 predicted 992
2 SASI_Hs02_00381003 predicted 1854
3 SASI_Hs02_00381004 predicted 1101
4 SASI_Hs02_00381005 predicted 597
5 SASI_Hs02_00381006 predicted 1749
6 SASI_Hs02_00381007 predicted 618
7 SASI_Hs02_00381008 predicted 937
8 SASI_Hs02_00381009 predicted 519
9 SASI_Hs02_00381010 predicted 1335
10 SASI_Hs02_00381011 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199076 predicted 219
2 SASI_Rn01_00031113 predicted 246
3 SASI_Rn02_00199077 predicted 200
4 SASI_Rn01_00031114 predicted 395
5 SASI_Rn01_00031115 predicted 657
6 SASI_Rn01_00031116 predicted 639
7 SASI_Rn01_00031117 predicted 914
8 SASI_Rn01_00031118 predicted 802
9 SASI_Rn01_00031120 predicted 500
10 SASI_Rn01_00031121 predicted 519
11 SASI_Rn01_00031119 predicted 742
12 SASI_Rn01_00031122 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307896 predicted 772
2 SASI_Mm02_00307897 predicted 219
3 SASI_Mm02_00307898 predicted 212
4 SASI_Mm02_00307899 predicted 657
5 SASI_Mm02_00307900 predicted 538
6 SASI_Mm02_00307901 predicted 761
7 SASI_Mm02_00307902 predicted 471
8 SASI_Mm02_00307903 predicted 347
9 SASI_Mm02_00307904 predicted 237
10 SASI_Mm02_00307905 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424489 predicted 1122
2 SASI_Mm02_00424490 predicted 743
3 SASI_Mm01_00234879 predicted 877
4 SASI_Mm02_00424491 predicted 1066
5 SASI_Mm02_00424492 predicted 981
6 SASI_Mm02_00424493 predicted 902
7 SASI_Mm02_00424494 predicted 977
8 SASI_Mm01_00234880 predicted 1104
9 SASI_Mm02_00424495 predicted 956
10 SASI_Mm01_00234881 predicted 819
11 SASI_Mm01_00234875 predicted 1127
12 SASI_Mm01_00234876 predicted 578
13 SASI_Mm01_00234877 predicted 557
14 SASI_Mm01_00234878 predicted 1001
15 SASI_Mm01_00234882 predicted 698
16 SASI_Mm01_00234883 predicted 582
17 SASI_Mm01_00234884 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214472 predicted 333
2 SASI_Mm01_00214473 predicted 324
3 SASI_Mm01_00214474 predicted 765
4 SASI_Mm01_00214475 predicted 649
5 SASI_Mm01_00214476 predicted 869
6 SASI_Mm01_00214477 predicted 585
7 SASI_Mm01_00214478 predicted 462
8 SASI_Mm01_00214479 predicted 288
9 SASI_Mm01_00214480 predicted 515
10 SASI_Mm01_00214481 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250663 predicted 780
2 SASI_Mm01_00250664 predicted 223
3 SASI_Mm01_00250665 predicted 214
4 SASI_Mm01_00250666 predicted 659
5 SASI_Mm01_00250667 predicted 546
6 SASI_Mm01_00250668 predicted 764
7 SASI_Mm01_00250669 predicted 474
8 SASI_Mm01_00250670 predicted 359
9 SASI_Mm01_00250671 predicted 235
10 SASI_Mm01_00250672 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443075 predicted 1117
2 SASI_Mm02_00443076 predicted 566
3 SASI_Mm02_00443077 predicted 554
4 SASI_Mm02_00443078 predicted 996
5 SASI_Mm02_00443079 predicted 878
6 SASI_Mm02_00443080 predicted 1108
7 SASI_Mm02_00443081 predicted 814
8 SASI_Mm02_00443082 predicted 696
9 SASI_Mm02_00443083 predicted 577
10 SASI_Mm02_00443084 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443085 predicted 772
2 SASI_Mm02_00443086 predicted 218
3 SASI_Mm02_00443087 predicted 215
4 SASI_Mm02_00443088 predicted 653
5 SASI_Mm02_00443089 predicted 533
6 SASI_Mm02_00443090 predicted 762
7 SASI_Mm02_00443091 predicted 475
8 SASI_Mm02_00443092 predicted 351
9 SASI_Mm02_00443093 predicted 232
10 SASI_Mm02_00443094 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113424
VALIDATED
AMN1 MISSION shRNA Bacterial Glycerol Stock
antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-115s21c1
Sequence:CCGGCAGTACCTAGTAATCAATATTCTCGAGAATATTGATTACTAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-214s21c1
Sequence:CCGGCGGATAACAGATTCCAATATACTCGAGTATATTGGAATCTGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-849s21c1
Sequence:CCGGTTTACCGAGGCTGATCTCAAACTCGAGTTTGAGATCAGCCTCGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-467s21c1
Sequence:CCGGTCCTTGCTCTTGCACTCAATTCTCGAGAATTGAGTGCAAGAGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-783s21c1
Sequence:CCGGAGAAGTCTTGGAGCAATTAATCTCGAGATTAATTGCTCCAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113424
VALIDATED
AMN1 MISSION shRNA shRNA Plasmid DNA
antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-115s21c1
Sequence:CCGGCAGTACCTAGTAATCAATATTCTCGAGAATATTGATTACTAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-214s21c1
Sequence:CCGGCGGATAACAGATTCCAATATACTCGAGTATATTGGAATCTGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-849s21c1
Sequence:CCGGTTTACCGAGGCTGATCTCAAACTCGAGTTTGAGATCAGCCTCGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-467s21c1
Sequence:CCGGTCCTTGCTCTTGCACTCAATTCTCGAGAATTGAGTGCAAGAGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-783s21c1
Sequence:CCGGAGAAGTCTTGGAGCAATTAATCTCGAGATTAATTGCTCCAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113424
VALIDATED
AMN1 MISSION shRNA Lentiviral Transduction Particles
antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-115s21c1
Sequence:CCGGCAGTACCTAGTAATCAATATTCTCGAGAATATTGATTACTAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-214s21c1
Sequence:CCGGCGGATAACAGATTCCAATATACTCGAGTATATTGGAATCTGTTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251606    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-849s21c1
Sequence:CCGGTTTACCGAGGCTGATCTCAAACTCGAGTTTGAGATCAGCCTCGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-467s21c1
Sequence:CCGGTCCTTGCTCTTGCACTCAATTCTCGAGAATTGAGTGCAAGAGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001113424.1-783s21c1
Sequence:CCGGAGAAGTCTTGGAGCAATTAATCTCGAGATTAATTGCTCCAAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_113708
AMN1 MISSION shRNA Bacterial Glycerol Stock
antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-931s1c1
Sequence:CCGGCGAGAAGTGTTGGAGCAATTACTCGAGTAATTGCTCCAACACTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-972s1c1
Sequence:CCGGGCAAGTGACATGGACTGTTTACTCGAGTAAACAGTCCATGTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_113708.5-1482s1c1
Sequence:CCGGCCTGAACATCAAGCCTGTTAACTCGAGTTAACAGGCTTGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_113708.5-1591s1c1
Sequence:CCGGGCCACATCCATTCATTGATTTCTCGAGAAATCAATGAATGGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-934s1c1
Sequence:CCGGGAAGTGTTGGAGCAATTAGTACTCGAGTACTAATTGCTCCAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_113708
AMN1 MISSION shRNA shRNA Plasmid DNA
antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-931s1c1
Sequence:CCGGCGAGAAGTGTTGGAGCAATTACTCGAGTAATTGCTCCAACACTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-972s1c1
Sequence:CCGGGCAAGTGACATGGACTGTTTACTCGAGTAAACAGTCCATGTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_113708.5-1482s1c1
Sequence:CCGGCCTGAACATCAAGCCTGTTAACTCGAGTTAACAGGCTTGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_113708.5-1591s1c1
Sequence:CCGGGCCACATCCATTCATTGATTTCTCGAGAAATCAATGAATGGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-934s1c1
Sequence:CCGGGAAGTGTTGGAGCAATTAGTACTCGAGTACTAATTGCTCCAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_113708
AMN1 MISSION shRNA Lentiviral Transduction Particles
antagonist of mitotic exit network 1 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-931s1c1
Sequence:CCGGCGAGAAGTGTTGGAGCAATTACTCGAGTAATTGCTCCAACACTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-972s1c1
Sequence:CCGGGCAAGTGACATGGACTGTTTACTCGAGTAAACAGTCCATGTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_113708.5-1482s1c1
Sequence:CCGGCCTGAACATCAAGCCTGTTAACTCGAGTTAACAGGCTTGATGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_113708.5-1591s1c1
Sequence:CCGGGCCACATCCATTCATTGATTTCTCGAGAAATCAATGAATGGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_113708.5-934s1c1
Sequence:CCGGGAAGTGTTGGAGCAATTAGTACTCGAGTACTAATTGCTCCAACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks