EMAIL THIS PAGE TO A FRIEND

AMOT

angiomotin

297 Gene Product Result for
UniProtKB ID: Q4VCS5, Q504X5, Q9HD27, Q9UPT1
Gene ID:
Human(154796) Summary: This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(27494) angiomotin
Rat(300289) angiomotin
Zebrafish(563421) angiomotin
dog(481022) angiomotin
chicken(422336) angiomotin
cow(535509) angiomotin
Horse(100054069) angiomotin
sheep(101108810) angiomotin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133265 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113490 Rosetta Predictions human pricing
NM_133265 Rosetta Predictions human pricing
XM_001056974 Rosetta Predictions rat pricing
XM_235733 Rosetta Predictions rat pricing
NM_153319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325881 predicted 2191
2 SASI_Hs02_00325882 predicted 2188
3 SASI_Hs02_00325883 predicted 2153
4 SASI_Hs02_00325884 predicted 2268
5 SASI_Hs02_00325885 predicted 2059
6 SASI_Hs02_00325886 predicted 3127
7 SASI_Hs02_00325887 predicted 1692
8 SASI_Hs02_00325888 predicted 2353
9 SASI_Hs02_00325889 predicted 3191
10 SASI_Hs02_00325890 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175496 predicted 1754
2 SASI_Hs01_00175497 predicted 1759
3 SASI_Hs01_00175498 predicted 1721
4 SASI_Hs01_00175499 predicted 1832
5 SASI_Hs01_00175500 predicted 1626
6 SASI_Hs01_00175501 predicted 2698
7 SASI_Hs01_00175502 predicted 1268
8 SASI_Hs01_00175503 predicted 1928
9 SASI_Hs01_00175504 predicted 2760
10 SASI_Hs01_00175505 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284990 predicted 473
2 SASI_Rn02_00284991 predicted 2322
3 SASI_Rn02_00284992 predicted 1360
4 SASI_Rn02_00284993 predicted 2062
5 SASI_Rn02_00284994 predicted 380
6 SASI_Rn02_00284995 predicted 3107
7 SASI_Rn02_00284996 predicted 2292
8 SASI_Rn02_00284997 predicted 1488
9 SASI_Rn02_00284998 predicted 283
10 SASI_Rn02_00284999 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389666 predicted 473
2 SASI_Rn02_00389667 predicted 2326
3 SASI_Rn02_00389668 predicted 1358
4 SASI_Rn02_00389669 predicted 2055
5 SASI_Rn02_00389670 predicted 383
6 SASI_Rn02_00389671 predicted 2287
7 SASI_Rn02_00389672 predicted 1484
8 SASI_Rn02_00389673 predicted 290
9 SASI_Rn02_00389674 predicted 490
10 SASI_Rn02_00389675 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343136 predicted 2753
2 SASI_Mm02_00343137 predicted 2792
3 SASI_Mm01_00166531 predicted 1467
4 SASI_Mm02_00343138 predicted 1700
5 SASI_Mm01_00166532 predicted 762
6 SASI_Mm02_00343139 predicted 889
7 SASI_Mm02_00343140 predicted 2655
8 SASI_Mm02_00343141 predicted 2804
9 SASI_Mm02_00343142 predicted 2805
10 SASI_Mm02_00343143 predicted 292
11 SASI_Mm01_00166533 predicted 830
12 SASI_Mm01_00166534 predicted 320
13 SASI_Mm01_00166535 predicted 295
14 SASI_Mm01_00166536 predicted 413
15 SASI_Mm01_00166537 predicted 1407
16 SASI_Mm01_00166538 predicted 431
17 SASI_Mm01_00166539 predicted 1013
18 SASI_Mm01_00166540 predicted 1488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153319
VALIDATED
AMOT MISSION shRNA Bacterial Glycerol Stock
angiomotin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-318s1c1
Sequence:CCGGCCAGGAACTCTCAACCTCATACTCGAGTATGAGGTTGAGAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-2641s1c1
Sequence:CCGGCCGCTTGTCTACACCAAATCTCTCGAGAGATTTGGTGTAGACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-1285s1c1
Sequence:CCGGGCCCACTAATGCTTCAGAATACTCGAGTATTCTGAAGCATTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153319.1-2644s1c1
Sequence:CCGGCTTGTCTACACCAAATCTGATCTCGAGATCAGATTTGGTGTAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-1403s1c1
Sequence:CCGGGAGAATGTGATGAGACACTTTCTCGAGAAAGTGTCTCATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-318s21c1
Sequence:CCGGCCAGGAACTCTCAACCTCATACTCGAGTATGAGGTTGAGAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153319.2-1757s21c1
Sequence:CCGGTTGACTGGTGCGCCCATTATGCTCGAGCATAATGGGCGCACCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-3039s21c1
Sequence:CCGGGTACAACTCATGGACTATTAACTCGAGTTAATAGTCCATGAGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-2647s21c1
Sequence:CCGGCCGCTTGTCTACACCAAATCTCTCGAGAGATTTGGTGTAGACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-1406s21c1
Sequence:CCGGGAGAATGTGATGAGACACTTTCTCGAGAAAGTGTCTCATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153319
VALIDATED
AMOT MISSION shRNA shRNA Plasmid DNA
angiomotin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-318s1c1
Sequence:CCGGCCAGGAACTCTCAACCTCATACTCGAGTATGAGGTTGAGAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-2641s1c1
Sequence:CCGGCCGCTTGTCTACACCAAATCTCTCGAGAGATTTGGTGTAGACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-1285s1c1
Sequence:CCGGGCCCACTAATGCTTCAGAATACTCGAGTATTCTGAAGCATTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153319.1-2644s1c1
Sequence:CCGGCTTGTCTACACCAAATCTGATCTCGAGATCAGATTTGGTGTAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-1403s1c1
Sequence:CCGGGAGAATGTGATGAGACACTTTCTCGAGAAAGTGTCTCATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-318s21c1
Sequence:CCGGCCAGGAACTCTCAACCTCATACTCGAGTATGAGGTTGAGAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153319.2-1757s21c1
Sequence:CCGGTTGACTGGTGCGCCCATTATGCTCGAGCATAATGGGCGCACCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-3039s21c1
Sequence:CCGGGTACAACTCATGGACTATTAACTCGAGTTAATAGTCCATGAGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-2647s21c1
Sequence:CCGGCCGCTTGTCTACACCAAATCTCTCGAGAGATTTGGTGTAGACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-1406s21c1
Sequence:CCGGGAGAATGTGATGAGACACTTTCTCGAGAAAGTGTCTCATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153319
VALIDATED
AMOT MISSION shRNA Lentiviral Transduction Particles
angiomotin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-318s1c1
Sequence:CCGGCCAGGAACTCTCAACCTCATACTCGAGTATGAGGTTGAGAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-2641s1c1
Sequence:CCGGCCGCTTGTCTACACCAAATCTCTCGAGAGATTTGGTGTAGACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-1285s1c1
Sequence:CCGGGCCCACTAATGCTTCAGAATACTCGAGTATTCTGAAGCATTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153319.1-2644s1c1
Sequence:CCGGCTTGTCTACACCAAATCTGATCTCGAGATCAGATTTGGTGTAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153319.1-1403s1c1
Sequence:CCGGGAGAATGTGATGAGACACTTTCTCGAGAAAGTGTCTCATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-318s21c1
Sequence:CCGGCCAGGAACTCTCAACCTCATACTCGAGTATGAGGTTGAGAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153319.2-1757s21c1
Sequence:CCGGTTGACTGGTGCGCCCATTATGCTCGAGCATAATGGGCGCACCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-3039s21c1
Sequence:CCGGGTACAACTCATGGACTATTAACTCGAGTTAATAGTCCATGAGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-2647s21c1
Sequence:CCGGCCGCTTGTCTACACCAAATCTCTCGAGAGATTTGGTGTAGACAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153319.2-1406s21c1
Sequence:CCGGGAGAATGTGATGAGACACTTTCTCGAGAAAGTGTCTCATCACATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133265
VALIDATED
AMOT MISSION shRNA Bacterial Glycerol Stock
angiomotin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-1277s1c1
Sequence:CCGGCGACACATCGAAATCCGAGATCTCGAGATCTCGGATTTCGATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-916s1c1
Sequence:CCGGGCAAGAGTTGGAAGGATGCTACTCGAGTAGCATCCTTCCAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-1628s1c1
Sequence:CCGGGAGGAGAATGTGATGAGACATCTCGAGATGTCTCATCACATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1763s1c1
Sequence:CCGGGAAGAAATCTTGATGGCCAATCTCGAGATTGGCCATCAAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1354s1c1
Sequence:CCGGGAAGCAAGTGTACGTTGACAACTCGAGTTGTCAACGTACACTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-2795s1c1
Sequence:CCGGGATGCAGAGATGGTGGAATATCTCGAGATATTCCACCATCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1587s1c1
Sequence:CCGGCTCTGGAAGCTGATATGACAACTCGAGTTGTCATATCAGCTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-1277s21c2
Sequence:CCGGCGACACATCGAAATCCGAGATCTCGAGATCTCGGATTTCGATGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-2795s21c2
Sequence:CCGGGATGCAGAGATGGTGGAATATCTCGAGATATTCCACCATCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-916s21c2
Sequence:CCGGGCAAGAGTTGGAAGGATGCTACTCGAGTAGCATCCTTCCAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-1628s21c2
Sequence:CCGGGAGGAGAATGTGATGAGACATCTCGAGATGTCTCATCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133265
VALIDATED
AMOT MISSION shRNA shRNA Plasmid DNA
angiomotin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-1277s1c1
Sequence:CCGGCGACACATCGAAATCCGAGATCTCGAGATCTCGGATTTCGATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-916s1c1
Sequence:CCGGGCAAGAGTTGGAAGGATGCTACTCGAGTAGCATCCTTCCAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-1628s1c1
Sequence:CCGGGAGGAGAATGTGATGAGACATCTCGAGATGTCTCATCACATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1763s1c1
Sequence:CCGGGAAGAAATCTTGATGGCCAATCTCGAGATTGGCCATCAAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1354s1c1
Sequence:CCGGGAAGCAAGTGTACGTTGACAACTCGAGTTGTCAACGTACACTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-2795s1c1
Sequence:CCGGGATGCAGAGATGGTGGAATATCTCGAGATATTCCACCATCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1587s1c1
Sequence:CCGGCTCTGGAAGCTGATATGACAACTCGAGTTGTCATATCAGCTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-1277s21c2
Sequence:CCGGCGACACATCGAAATCCGAGATCTCGAGATCTCGGATTTCGATGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-2795s21c2
Sequence:CCGGGATGCAGAGATGGTGGAATATCTCGAGATATTCCACCATCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-916s21c2
Sequence:CCGGGCAAGAGTTGGAAGGATGCTACTCGAGTAGCATCCTTCCAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-1628s21c2
Sequence:CCGGGAGGAGAATGTGATGAGACATCTCGAGATGTCTCATCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133265
VALIDATED
AMOT MISSION shRNA Lentiviral Transduction Particles
angiomotin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-1277s1c1
Sequence:CCGGCGACACATCGAAATCCGAGATCTCGAGATCTCGGATTTCGATGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-916s1c1
Sequence:CCGGGCAAGAGTTGGAAGGATGCTACTCGAGTAGCATCCTTCCAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-1628s1c1
Sequence:CCGGGAGGAGAATGTGATGAGACATCTCGAGATGTCTCATCACATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1763s1c1
Sequence:CCGGGAAGAAATCTTGATGGCCAATCTCGAGATTGGCCATCAAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1354s1c1
Sequence:CCGGGAAGCAAGTGTACGTTGACAACTCGAGTTGTCAACGTACACTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_133265.1-2795s1c1
Sequence:CCGGGATGCAGAGATGGTGGAATATCTCGAGATATTCCACCATCTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133265.1-1587s1c1
Sequence:CCGGCTCTGGAAGCTGATATGACAACTCGAGTTGTCATATCAGCTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-1277s21c2
Sequence:CCGGCGACACATCGAAATCCGAGATCTCGAGATCTCGGATTTCGATGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-2795s21c2
Sequence:CCGGGATGCAGAGATGGTGGAATATCTCGAGATATTCCACCATCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-916s21c2
Sequence:CCGGGCAAGAGTTGGAAGGATGCTACTCGAGTAGCATCCTTCCAACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133265.2-1628s21c2
Sequence:CCGGGAGGAGAATGTGATGAGACATCTCGAGATGTCTCATCACATTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks