EMAIL THIS PAGE TO A FRIEND

AMOTL1

angiomotin like 1

127 Gene Product Result for
Synonyms: JEAP
UniProtKB ID: Q8IY63, Q63HK7, Q8NDN0, Q8TEN8, Q8WXD1, Q96CM5
Gene ID:
Human(154810) Summary: The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. [provided by RefSeq, Jul 2008]
Mouse(75723) angiomotin-like 1
Rat(315430) angiomotin-like 1
naked mole-rat(101712095) angiomotin like 1
domestic guinea pig(100720059) angiomotin like 1
sheep(101103590) angiomotin like 1
Domestic Rabbit(100348712) angiomotin like 1
chicken(428091) angiomotin like 1
cow(541209) angiomotin like 1
domestic cat(101085658) angiomotin like 1
dog(485122) angiomotin like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130847 Rosetta Predictions human pricing
NM_001108126 Rosetta Predictions rat pricing
NM_001081395 Rosetta Predictions mouse pricing
XM_976419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211738 predicted 2135
2 SASI_Hs01_00211739 predicted 1977
3 SASI_Hs01_00211740 predicted 236
4 SASI_Hs01_00211741 predicted 1613
5 SASI_Hs01_00211742 predicted 1010
6 SASI_Hs01_00211743 predicted 1750
7 SASI_Hs01_00211744 predicted 1546
8 SASI_Hs02_00362890 predicted 1798
9 SASI_Hs01_00211745 predicted 1493
10 SASI_Hs01_00211746 predicted 3128
11 SASI_Hs01_00211747 predicted 3014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235614 predicted 1982
2 SASI_Rn02_00235615 predicted 643
3 SASI_Rn02_00235616 predicted 2067
4 SASI_Rn02_00235617 predicted 784
5 SASI_Rn02_00235618 predicted 1987
6 SASI_Rn02_00235619 predicted 684
7 SASI_Rn02_00235620 predicted 776
8 SASI_Rn02_00235621 predicted 574
9 SASI_Rn02_00235622 predicted 1102
10 SASI_Rn02_00235623 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297981 predicted 1840
2 SASI_Mm02_00297982 predicted 338
3 SASI_Mm02_00297983 predicted 1646
4 SASI_Mm02_00297984 predicted 2028
5 SASI_Mm02_00297985 predicted 1222
6 SASI_Mm02_00297986 predicted 360
7 SASI_Mm02_00297987 predicted 1789
8 SASI_Mm02_00297988 predicted 1744
9 SASI_Mm02_00297989 predicted 3100
10 SASI_Mm02_00297990 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261585 predicted 1883
2 SASI_Mm01_00261586 predicted 1851
3 SASI_Mm01_00261587 predicted 349
4 SASI_Mm01_00261588 predicted 1646
5 SASI_Mm01_00261589 predicted 2025
6 SASI_Mm01_00261590 predicted 1233
7 SASI_Mm01_00261591 predicted 1792
8 SASI_Mm01_00261592 predicted 1752
9 SASI_Mm01_00261593 predicted 3101
10 SASI_Mm01_00261594 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130847
VALIDATED
AMOTL1 MISSION shRNA Bacterial Glycerol Stock
angiomotin like 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-602s21c1
Sequence:CCGGCACTCAAGAAGACCCACAAATCTCGAGATTTGTGGGTCTTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3421s21c1
Sequence:CCGGCCTTGCCTCTTAGCATGTTTGCTCGAGCAAACATGCTAAGAGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-1691s21c1
Sequence:CCGGGATTAGAAGACTTCATGATTTCTCGAGAAATCATGAAGTCTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3136s21c1
Sequence:CCCGAGGAATGATTTGAACTGATAACTCGAGTTATCAGTTCAAATCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3470s21c1
Sequence:CCGGAGAGCCTGTCTTGGCATAATGCTCGAGCATTATGCCAAGACAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-2260s21c1
Sequence:CCGGTCCGACACTTTGCCATGAATGCTCGAGCATTCATGGCAAAGTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-887s21c1
Sequence:CCGGCAACAGTGGACAGGCGCATAACTCGAGTTATGCGCCTGTCCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-1739s21c1
Sequence:CCGGGACTGCTAACAGGCAACTATCCTCGAGGATAGTTGCCTGTTAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-535s1c1
Sequence:CCGGGCCCATCCTACAAACAACTTTCTCGAGAAAGTTGTTTGTAGGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-2386s1c1
Sequence:CCGGCAGGACATGGAATACACTATTCTCGAGAATAGTGTATTCCATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130847.1-1944s1c1
Sequence:CCGGGAAGCAAGCATATGTTGAGAACTCGAGTTCTCAACATATGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130847.1-1516s1c1
Sequence:CCGGCTTCAGGGTTACTACGACAATCTCGAGATTGTCGTAGTAACCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_130847.1-1465s1c1
Sequence:CCGGCAGCAAATGGTGGAGATATTACTCGAGTAATATCTCCACCATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-1464s1c1
Sequence:CCGGCCAGCAAATGGTGGAGATATTCTCGAGAATATCTCCACCATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-1636s1c1
Sequence:CCGGGCCATGAGAAACAAATTGGAACTCGAGTTCCAATTTGTTTCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130847.1-4519s1c1
Sequence:CCGGCCCAGTAATCATCAGTGTGATCTCGAGATCACACTGATGATTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130847.1-1774s1c1
Sequence:CCGGCATTATGCTTCCCAGAACAAACTCGAGTTTGTTCTGGGAAGCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_130847.1-2384s1c1
Sequence:CCGGGTCAGGACATGGAATACACTACTCGAGTAGTGTATTCCATGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130847
VALIDATED
AMOTL1 MISSION shRNA shRNA Plasmid DNA
angiomotin like 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-602s21c1
Sequence:CCGGCACTCAAGAAGACCCACAAATCTCGAGATTTGTGGGTCTTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3421s21c1
Sequence:CCGGCCTTGCCTCTTAGCATGTTTGCTCGAGCAAACATGCTAAGAGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-1691s21c1
Sequence:CCGGGATTAGAAGACTTCATGATTTCTCGAGAAATCATGAAGTCTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3136s21c1
Sequence:CCCGAGGAATGATTTGAACTGATAACTCGAGTTATCAGTTCAAATCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3470s21c1
Sequence:CCGGAGAGCCTGTCTTGGCATAATGCTCGAGCATTATGCCAAGACAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-2260s21c1
Sequence:CCGGTCCGACACTTTGCCATGAATGCTCGAGCATTCATGGCAAAGTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-887s21c1
Sequence:CCGGCAACAGTGGACAGGCGCATAACTCGAGTTATGCGCCTGTCCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-1739s21c1
Sequence:CCGGGACTGCTAACAGGCAACTATCCTCGAGGATAGTTGCCTGTTAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-535s1c1
Sequence:CCGGGCCCATCCTACAAACAACTTTCTCGAGAAAGTTGTTTGTAGGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-2386s1c1
Sequence:CCGGCAGGACATGGAATACACTATTCTCGAGAATAGTGTATTCCATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130847.1-1944s1c1
Sequence:CCGGGAAGCAAGCATATGTTGAGAACTCGAGTTCTCAACATATGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130847.1-1516s1c1
Sequence:CCGGCTTCAGGGTTACTACGACAATCTCGAGATTGTCGTAGTAACCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_130847.1-1465s1c1
Sequence:CCGGCAGCAAATGGTGGAGATATTACTCGAGTAATATCTCCACCATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-1464s1c1
Sequence:CCGGCCAGCAAATGGTGGAGATATTCTCGAGAATATCTCCACCATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-1636s1c1
Sequence:CCGGGCCATGAGAAACAAATTGGAACTCGAGTTCCAATTTGTTTCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130847.1-4519s1c1
Sequence:CCGGCCCAGTAATCATCAGTGTGATCTCGAGATCACACTGATGATTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130847.1-1774s1c1
Sequence:CCGGCATTATGCTTCCCAGAACAAACTCGAGTTTGTTCTGGGAAGCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_130847.1-2384s1c1
Sequence:CCGGGTCAGGACATGGAATACACTACTCGAGTAGTGTATTCCATGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130847
VALIDATED
AMOTL1 MISSION shRNA Lentiviral Transduction Particles
angiomotin like 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-602s21c1
Sequence:CCGGCACTCAAGAAGACCCACAAATCTCGAGATTTGTGGGTCTTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3421s21c1
Sequence:CCGGCCTTGCCTCTTAGCATGTTTGCTCGAGCAAACATGCTAAGAGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-1691s21c1
Sequence:CCGGGATTAGAAGACTTCATGATTTCTCGAGAAATCATGAAGTCTTCTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3136s21c1
Sequence:CCCGAGGAATGATTTGAACTGATAACTCGAGTTATCAGTTCAAATCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130847.2-3470s21c1
Sequence:CCGGAGAGCCTGTCTTGGCATAATGCTCGAGCATTATGCCAAGACAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-2260s21c1
Sequence:CCGGTCCGACACTTTGCCATGAATGCTCGAGCATTCATGGCAAAGTGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-887s21c1
Sequence:CCGGCAACAGTGGACAGGCGCATAACTCGAGTTATGCGCCTGTCCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130847.2-1739s21c1
Sequence:CCGGGACTGCTAACAGGCAACTATCCTCGAGGATAGTTGCCTGTTAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-535s1c1
Sequence:CCGGGCCCATCCTACAAACAACTTTCTCGAGAAAGTTGTTTGTAGGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-2386s1c1
Sequence:CCGGCAGGACATGGAATACACTATTCTCGAGAATAGTGTATTCCATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130847.1-1944s1c1
Sequence:CCGGGAAGCAAGCATATGTTGAGAACTCGAGTTCTCAACATATGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130847.1-1516s1c1
Sequence:CCGGCTTCAGGGTTACTACGACAATCTCGAGATTGTCGTAGTAACCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_130847.1-1465s1c1
Sequence:CCGGCAGCAAATGGTGGAGATATTACTCGAGTAATATCTCCACCATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-1464s1c1
Sequence:CCGGCCAGCAAATGGTGGAGATATTCTCGAGAATATCTCCACCATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130847.1-1636s1c1
Sequence:CCGGGCCATGAGAAACAAATTGGAACTCGAGTTCCAATTTGTTTCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130847.1-4519s1c1
Sequence:CCGGCCCAGTAATCATCAGTGTGATCTCGAGATCACACTGATGATTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130847.1-1774s1c1
Sequence:CCGGCATTATGCTTCCCAGAACAAACTCGAGTTTGTTCTGGGAAGCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_130847.1-2384s1c1
Sequence:CCGGGTCAGGACATGGAATACACTACTCGAGTAGTGTATTCCATGTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081395
VALIDATED
AMOTL1 MISSION shRNA Bacterial Glycerol Stock
angiomotin like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-1232s21c1
Sequence:CCGGGAACCAAGATCACGGTCTTTACTCGAGTAAAGACCGTGATCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081395.1-5851s21c1
Sequence:CCGGCTAAACCCAAGCCTCATATAACTCGAGTTATATGAGGCTTGGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-971s21c1
Sequence:CCGGCAACAGTGGACAGGCGCATAACTCGAGTTATGCGCCTGTCCACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-2498s21c1
Sequence:CCGGGGACATGGAGTACACTATTAACTCGAGTTAATAGTGTACTCCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-1756s21c1
Sequence:CCGGCCAAGCTCGAAGGCGAGATAACTCGAGTTATCTCGCCTTCGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081395
VALIDATED
AMOTL1 MISSION shRNA shRNA Plasmid DNA
angiomotin like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-1232s21c1
Sequence:CCGGGAACCAAGATCACGGTCTTTACTCGAGTAAAGACCGTGATCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081395.1-5851s21c1
Sequence:CCGGCTAAACCCAAGCCTCATATAACTCGAGTTATATGAGGCTTGGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-971s21c1
Sequence:CCGGCAACAGTGGACAGGCGCATAACTCGAGTTATGCGCCTGTCCACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-2498s21c1
Sequence:CCGGGGACATGGAGTACACTATTAACTCGAGTTAATAGTGTACTCCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-1756s21c1
Sequence:CCGGCCAAGCTCGAAGGCGAGATAACTCGAGTTATCTCGCCTTCGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081395
VALIDATED
AMOTL1 MISSION shRNA Lentiviral Transduction Particles
angiomotin like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-1232s21c1
Sequence:CCGGGAACCAAGATCACGGTCTTTACTCGAGTAAAGACCGTGATCTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081395.1-5851s21c1
Sequence:CCGGCTAAACCCAAGCCTCATATAACTCGAGTTATATGAGGCTTGGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-971s21c1
Sequence:CCGGCAACAGTGGACAGGCGCATAACTCGAGTTATGCGCCTGTCCACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-2498s21c1
Sequence:CCGGGGACATGGAGTACACTATTAACTCGAGTTAATAGTGTACTCCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081395.1-1756s21c1
Sequence:CCGGCCAAGCTCGAAGGCGAGATAACTCGAGTTATCTCGCCTTCGAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks