EMAIL THIS PAGE TO A FRIEND

AMOTL2

angiomotin like 2

118 Gene Product Result for
Synonyms: LCCP
Gene ID:
Human(51421) Summary: Angiomotin is a protein that binds angiostatin, a circulating inhibitor of the formation of new blood vessels (angiogenesis). Angiomotin mediates angiostatin inhibition of endothelial cell migration and tube formation in vitro. The protein encoded by this gene is related to angiomotin and is a member of the motin protein family. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(56332) angiomotin-like 2
Rat(65157) angiomotin like 2
chicken(424863) angiomotin like 2
dog(485669) angiomotin like 2
cow(538514) angiomotin like 2
domestic cat(101086593) angiomotin like 2
sheep(101114081) angiomotin like 2
domestic guinea pig(100727886) angiomotin like 2
naked mole-rat(101723019) angiomotin like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016201 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135381 MISSION® esiRNA esiRNA human AMOTL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016201 Rosetta Predictions human pricing
XM_001060762 Rosetta Predictions rat pricing
XM_001068539 Rosetta Predictions rat pricing
XM_343457 Rosetta Predictions rat pricing
NM_019764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044388 predicted 1461
2 SASI_Hs01_00044389 predicted 915
3 SASI_Hs01_00044390 predicted 2599
4 SASI_Hs01_00044391 predicted 1448
5 SASI_Hs01_00044392 predicted 916
6 SASI_Hs01_00044394 predicted 594
7 SASI_Hs02_00349038 predicted 924
8 SASI_Hs01_00044395 predicted 2853
9 SASI_Hs01_00044396 predicted 1923
10 SASI_Hs02_00349039 predicted 2868
11 SASI_Hs01_00044387 predicted 2344
12 SASI_Hs01_00044393 predicted 2849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297651 predicted 1439
2 SASI_Rn02_00297652 predicted 2382
3 SASI_Rn02_00297653 predicted 965
4 SASI_Rn02_00297654 predicted 2396
5 SASI_Rn02_00297655 predicted 2508
6 SASI_Rn02_00297656 predicted 2416
7 SASI_Rn02_00297657 predicted 2525
8 SASI_Rn02_00297658 predicted 2508
9 SASI_Rn02_00297659 predicted 2184
10 SASI_Rn02_00297660 predicted 2504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324865 predicted 2556
2 SASI_Rn02_00324866 predicted 1430
3 SASI_Rn02_00324867 predicted 963
4 SASI_Rn02_00324868 predicted 1357
5 SASI_Rn02_00324869 predicted 819
6 SASI_Rn02_00324870 predicted 1410
7 SASI_Rn02_00324871 predicted 1466
8 SASI_Rn02_00324872 predicted 2205
9 SASI_Rn02_00324873 predicted 996
10 SASI_Rn02_00324874 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395794 predicted 2561
2 SASI_Rn02_00395795 predicted 1430
3 SASI_Rn02_00395796 predicted 959
4 SASI_Rn02_00395797 predicted 1356
5 SASI_Rn02_00395798 predicted 819
6 SASI_Rn02_00395799 predicted 1412
7 SASI_Rn02_00395800 predicted 1463
8 SASI_Rn02_00395801 predicted 2205
9 SASI_Rn02_00395802 predicted 1000
10 SASI_Rn02_00395803 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324944 predicted 2422
2 SASI_Mm02_00324945 predicted 1326
3 SASI_Mm02_00324946 predicted 2449
4 SASI_Mm02_00324947 predicted 1878
5 SASI_Mm02_00324948 predicted 634
6 SASI_Mm02_00324949 predicted 685
7 SASI_Mm01_00188451 predicted 1121
8 SASI_Mm02_00324950 predicted 2550
9 SASI_Mm02_00324951 predicted 460
10 SASI_Mm02_00324952 predicted 469
11 SASI_Mm01_00188449 predicted 2979
12 SASI_Mm01_00188450 predicted 2341
13 SASI_Mm01_00188452 predicted 1261
14 SASI_Mm01_00188453 predicted 1289
15 SASI_Mm01_00188454 predicted 3043
16 SASI_Mm01_00188455 predicted 1290
17 SASI_Mm01_00188456 predicted 3040
18 SASI_Mm01_00188457 predicted 1767
19 SASI_Mm01_00188458 predicted 1313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019764
VALIDATED
AMOTL2 MISSION shRNA Bacterial Glycerol Stock
angiomotin like 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019764.1-1462s1c1
Sequence:CCGGCCGAGACCTTAGAGAGAGATTCTCGAGAATCTCTCTCTAAGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019764.1-1703s1c1
Sequence:CCGGGCTGAAGAAGAGCTACGCAAACTCGAGTTTGCGTAGCTCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-2000s1c1
Sequence:CCGGGAACAGAAGTATTTGGAAGAACTCGAGTTCTTCCAAATACTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019764.1-3987s1c1
Sequence:CCGGCCCTATGTAAAGCTGAGAAATCTCGAGATTTCTCAGCTTTACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-2591s1c1
Sequence:CCGGCTGTCAGACATGGTAGAAATACTCGAGTATTTCTACCATGTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019764.1-2008s1c1
Sequence:CCGGGTATTTGGAAGAACGGGCTATCTCGAGATAGCCCGTTCTTCCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019764.1-1473s1c1
Sequence:CCGGGAGAGAGATTGGAATCGGCAACTCGAGTTGCCGATTCCAATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-1408s1c1
Sequence:CCGGGAAGACCATGAGGAACAAGATCTCGAGATCTTGTTCCTCATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-1992s1c1
Sequence:CCGGCCAAGTGGGAACAGAAGTATTCTCGAGAATACTTCTGTTCCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-834s21c1
Sequence:CCGGGCTGTCACTGACCCAAGATACCTCGAGGTATCTTGGGTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-2410s21c1
Sequence:CCGGCACCCTCTCTGGACTCTATAGCTCGAGCTATAGAGTCCAGAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019764.2-2904s21c1
Sequence:CCGGTGACTTCCTCAGATCACTAAGCTCGAGCTTAGTGATCTGAGGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-2452s21c1
Sequence:CCGGTGTCAGACATGGTAGAAATACCTCGAGGTATTTCTACCATGTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019764.2-797s21c1
Sequence:CCGGTCAGTACCCACACGCTGTAATCTCGAGATTACAGCGTGTGGGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019764
VALIDATED
AMOTL2 MISSION shRNA shRNA Plasmid DNA
angiomotin like 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019764.1-1462s1c1
Sequence:CCGGCCGAGACCTTAGAGAGAGATTCTCGAGAATCTCTCTCTAAGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019764.1-1703s1c1
Sequence:CCGGGCTGAAGAAGAGCTACGCAAACTCGAGTTTGCGTAGCTCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-2000s1c1
Sequence:CCGGGAACAGAAGTATTTGGAAGAACTCGAGTTCTTCCAAATACTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019764.1-3987s1c1
Sequence:CCGGCCCTATGTAAAGCTGAGAAATCTCGAGATTTCTCAGCTTTACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-2591s1c1
Sequence:CCGGCTGTCAGACATGGTAGAAATACTCGAGTATTTCTACCATGTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019764.1-2008s1c1
Sequence:CCGGGTATTTGGAAGAACGGGCTATCTCGAGATAGCCCGTTCTTCCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019764.1-1473s1c1
Sequence:CCGGGAGAGAGATTGGAATCGGCAACTCGAGTTGCCGATTCCAATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-1408s1c1
Sequence:CCGGGAAGACCATGAGGAACAAGATCTCGAGATCTTGTTCCTCATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-1992s1c1
Sequence:CCGGCCAAGTGGGAACAGAAGTATTCTCGAGAATACTTCTGTTCCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-834s21c1
Sequence:CCGGGCTGTCACTGACCCAAGATACCTCGAGGTATCTTGGGTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-2410s21c1
Sequence:CCGGCACCCTCTCTGGACTCTATAGCTCGAGCTATAGAGTCCAGAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019764.2-2904s21c1
Sequence:CCGGTGACTTCCTCAGATCACTAAGCTCGAGCTTAGTGATCTGAGGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-2452s21c1
Sequence:CCGGTGTCAGACATGGTAGAAATACCTCGAGGTATTTCTACCATGTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019764.2-797s21c1
Sequence:CCGGTCAGTACCCACACGCTGTAATCTCGAGATTACAGCGTGTGGGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019764
VALIDATED
AMOTL2 MISSION shRNA Lentiviral Transduction Particles
angiomotin like 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019764.1-1462s1c1
Sequence:CCGGCCGAGACCTTAGAGAGAGATTCTCGAGAATCTCTCTCTAAGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019764.1-1703s1c1
Sequence:CCGGGCTGAAGAAGAGCTACGCAAACTCGAGTTTGCGTAGCTCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-2000s1c1
Sequence:CCGGGAACAGAAGTATTTGGAAGAACTCGAGTTCTTCCAAATACTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019764.1-3987s1c1
Sequence:CCGGCCCTATGTAAAGCTGAGAAATCTCGAGATTTCTCAGCTTTACATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-2591s1c1
Sequence:CCGGCTGTCAGACATGGTAGAAATACTCGAGTATTTCTACCATGTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019764.1-2008s1c1
Sequence:CCGGGTATTTGGAAGAACGGGCTATCTCGAGATAGCCCGTTCTTCCAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019764.1-1473s1c1
Sequence:CCGGGAGAGAGATTGGAATCGGCAACTCGAGTTGCCGATTCCAATCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-1408s1c1
Sequence:CCGGGAAGACCATGAGGAACAAGATCTCGAGATCTTGTTCCTCATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019764.1-1992s1c1
Sequence:CCGGCCAAGTGGGAACAGAAGTATTCTCGAGAATACTTCTGTTCCCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-834s21c1
Sequence:CCGGGCTGTCACTGACCCAAGATACCTCGAGGTATCTTGGGTCAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-2410s21c1
Sequence:CCGGCACCCTCTCTGGACTCTATAGCTCGAGCTATAGAGTCCAGAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019764.2-2904s21c1
Sequence:CCGGTGACTTCCTCAGATCACTAAGCTCGAGCTTAGTGATCTGAGGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019764.2-2452s21c1
Sequence:CCGGTGTCAGACATGGTAGAAATACCTCGAGGTATTTCTACCATGTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019764.2-797s21c1
Sequence:CCGGTCAGTACCCACACGCTGTAATCTCGAGATTACAGCGTGTGGGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016201
AMOTL2 MISSION shRNA Bacterial Glycerol Stock
angiomotin like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1403s1c1
Sequence:CCGGGAAGACCATGCGGAACAAGATCTCGAGATCTTGTTCCGCATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1928s1c1
Sequence:CCGGGTCAGAACAACTGCGAGAGAACTCGAGTTCTCTCGCAGTTGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016201.2-2824s1c1
Sequence:CCGGCCCAGAAGACTCTGCTTCTTACTCGAGTAAGAAGCAGAGTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1470s1c1
Sequence:CCGGGAGAGATTGGAATCTGCAAATCTCGAGATTTGCAGATTCCAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016201.2-1415s1c1
Sequence:CCGGGAACAAGATGGACAGTGAAATCTCGAGATTTCACTGTCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-918s1c1
Sequence:CCGGCAGTACCCTCATGTTGTACTACTCGAGTAGTACAACATGAGGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016201.2-1457s1c1
Sequence:CCGGCCGGGATCTTAGAGAGAGATTCTCGAGAATCTCTCTCTAAGATCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016201
AMOTL2 MISSION shRNA shRNA Plasmid DNA
angiomotin like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1403s1c1
Sequence:CCGGGAAGACCATGCGGAACAAGATCTCGAGATCTTGTTCCGCATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1928s1c1
Sequence:CCGGGTCAGAACAACTGCGAGAGAACTCGAGTTCTCTCGCAGTTGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016201.2-2824s1c1
Sequence:CCGGCCCAGAAGACTCTGCTTCTTACTCGAGTAAGAAGCAGAGTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1470s1c1
Sequence:CCGGGAGAGATTGGAATCTGCAAATCTCGAGATTTGCAGATTCCAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016201.2-1415s1c1
Sequence:CCGGGAACAAGATGGACAGTGAAATCTCGAGATTTCACTGTCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-918s1c1
Sequence:CCGGCAGTACCCTCATGTTGTACTACTCGAGTAGTACAACATGAGGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016201.2-1457s1c1
Sequence:CCGGCCGGGATCTTAGAGAGAGATTCTCGAGAATCTCTCTCTAAGATCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016201
AMOTL2 MISSION shRNA Lentiviral Transduction Particles
angiomotin like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1403s1c1
Sequence:CCGGGAAGACCATGCGGAACAAGATCTCGAGATCTTGTTCCGCATGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1928s1c1
Sequence:CCGGGTCAGAACAACTGCGAGAGAACTCGAGTTCTCTCGCAGTTGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016201.2-2824s1c1
Sequence:CCGGCCCAGAAGACTCTGCTTCTTACTCGAGTAAGAAGCAGAGTCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-1470s1c1
Sequence:CCGGGAGAGATTGGAATCTGCAAATCTCGAGATTTGCAGATTCCAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016201.2-1415s1c1
Sequence:CCGGGAACAAGATGGACAGTGAAATCTCGAGATTTCACTGTCCATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016201.2-918s1c1
Sequence:CCGGCAGTACCCTCATGTTGTACTACTCGAGTAGTACAACATGAGGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016201.2-1457s1c1
Sequence:CCGGCCGGGATCTTAGAGAGAGATTCTCGAGAATCTCTCTCTAAGATCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks