EMAIL THIS PAGE TO A FRIEND

AMPD1

adenosine monophosphate deaminase 1

56 Gene Product Result for
Synonyms: MAD MADA
UniProtKB ID: P23109, A8K5N4, B2RAM1, F2Z3B3, Q5TF00, Q5TF02
Gene ID:
Human(270) Summary: Adenosine monophosphate deaminase 1 catalyzes the deamination of AMP to IMP in skeletal muscle and plays an important role in the purine nucleotide cycle. Two other genes have been identified, AMPD2 and AMPD3, for the liver- and erythocyte-specific isoforms, respectively. Deficiency of the muscle-specific enzyme is apparently a common cause of exercise-induced myopathy and probably the most common cause of metabolic myopathy in the human. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Mouse(229665) adenosine monophosphate deaminase 1
Rat(25028) adenosine monophosphate deaminase 1
naked mole-rat(101718930) adenosine monophosphate deaminase 1
domestic guinea pig(100720840) adenosine monophosphate deaminase 1
sheep(101102023) adenosine monophosphate deaminase 1
Domestic Rabbit(100344490) adenosine monophosphate deaminase 1
Zebrafish(393867) adenosine monophosphate deaminase 1 (isoform M)
dog(606901) adenosine monophosphate deaminase 1
domestic cat(101096963) adenosine monophosphate deaminase 1
Horse(100065374) adenosine monophosphate deaminase 1
cow(512748) adenosine monophosphate deaminase 1
chicken(772125) adenosine monophosphate deaminase 1
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000036 Rosetta Predictions human pricing
NM_138876 Rosetta Predictions rat pricing
NM_001033303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301720 predicted 249
2 SASI_Hs02_00301721 predicted 1090
3 SASI_Hs01_00010872 predicted 562
4 SASI_Hs01_00010873 predicted 363
5 SASI_Hs01_00010874 predicted 1823
6 SASI_Hs01_00010875 predicted 1937
7 SASI_Hs01_00010876 predicted 323
8 SASI_Hs01_00010878 predicted 431
9 SASI_Hs01_00010879 predicted 1694
10 SASI_Hs01_00010880 predicted 1912
11 SASI_Hs01_00010871 predicted 372
12 SASI_Hs01_00010877 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060501 predicted 1748
2 SASI_Rn01_00060504 predicted 1329
3 SASI_Rn01_00060505 predicted 1585
4 SASI_Rn01_00060506 predicted 1056
5 SASI_Rn01_00060507 predicted 1656
6 SASI_Rn01_00060508 predicted 426
7 SASI_Rn02_00268300 predicted 1521
8 SASI_Rn02_00268301 predicted 292
9 SASI_Rn01_00060509 predicted 811
10 SASI_Rn01_00060510 predicted 964
11 SASI_Rn01_00060502 predicted 1769
12 SASI_Rn01_00060503 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144434 predicted 1021
2 SASI_Mm02_00288506 predicted 1696
3 SASI_Mm01_00144436 predicted 858
4 SASI_Mm01_00144437 predicted 1585
5 SASI_Mm01_00144438 predicted 493
6 SASI_Mm01_00144439 predicted 372
7 SASI_Mm01_00144440 predicted 469
8 SASI_Mm02_00288507 predicted 748
9 SASI_Mm01_00144441 predicted 1694
10 SASI_Mm01_00144442 predicted 836
11 SASI_Mm01_00144435 predicted 1521
12 SASI_Mm01_00144443 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000036
AMPD1 MISSION shRNA Bacterial Glycerol Stock
adenosine monophosphate deaminase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000036.2-1919s21c1
Sequence:CCGGATATCTCTCATGGCCTAAATTCTCGAGAATTTAGGCCATGAGAGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000036.2-978s21c1
Sequence:CCGGTAACGAGATGGACGAGTTAAACTCGAGTTTAACTCGTCCATCTCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-1888s1c1
Sequence:CCGGCCCGTGCTACAGTACTTGTTTCTCGAGAAACAAGTACTGTAGCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-567s1c1
Sequence:CCGGCCCTTCCAAATACTTGCGGAACTCGAGTTCCGCAAGTATTTGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-2176s1c1
Sequence:CCGGGTAAAGTTTCTGGGCGACAATCTCGAGATTGTCGCCCAGAAACTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-670s1c1
Sequence:CCGGCGAACAGACAACCTTCCTGAACTCGAGTTCAGGAAGGTTGTCTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-374s1c1
Sequence:CCGGCCCACATTGATGAATACATTTCTCGAGAAATGTATTCATCAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000036
AMPD1 MISSION shRNA shRNA Plasmid DNA
adenosine monophosphate deaminase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000036.2-1919s21c1
Sequence:CCGGATATCTCTCATGGCCTAAATTCTCGAGAATTTAGGCCATGAGAGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000036.2-978s21c1
Sequence:CCGGTAACGAGATGGACGAGTTAAACTCGAGTTTAACTCGTCCATCTCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-1888s1c1
Sequence:CCGGCCCGTGCTACAGTACTTGTTTCTCGAGAAACAAGTACTGTAGCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-567s1c1
Sequence:CCGGCCCTTCCAAATACTTGCGGAACTCGAGTTCCGCAAGTATTTGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-2176s1c1
Sequence:CCGGGTAAAGTTTCTGGGCGACAATCTCGAGATTGTCGCCCAGAAACTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-670s1c1
Sequence:CCGGCGAACAGACAACCTTCCTGAACTCGAGTTCAGGAAGGTTGTCTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-374s1c1
Sequence:CCGGCCCACATTGATGAATACATTTCTCGAGAAATGTATTCATCAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000036
AMPD1 MISSION shRNA Lentiviral Transduction Particles
adenosine monophosphate deaminase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000036.2-1919s21c1
Sequence:CCGGATATCTCTCATGGCCTAAATTCTCGAGAATTTAGGCCATGAGAGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000036.2-978s21c1
Sequence:CCGGTAACGAGATGGACGAGTTAAACTCGAGTTTAACTCGTCCATCTCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-1888s1c1
Sequence:CCGGCCCGTGCTACAGTACTTGTTTCTCGAGAAACAAGTACTGTAGCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-567s1c1
Sequence:CCGGCCCTTCCAAATACTTGCGGAACTCGAGTTCCGCAAGTATTTGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-2176s1c1
Sequence:CCGGGTAAAGTTTCTGGGCGACAATCTCGAGATTGTCGCCCAGAAACTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-670s1c1
Sequence:CCGGCGAACAGACAACCTTCCTGAACTCGAGTTCAGGAAGGTTGTCTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000036.1-374s1c1
Sequence:CCGGCCCACATTGATGAATACATTTCTCGAGAAATGTATTCATCAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033303
AMPD1 MISSION shRNA Bacterial Glycerol Stock
adenosine monophosphate deaminase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1944s21c1
Sequence:CCGGACAGTCTGTTCCTCGAATATGCTCGAGCATATTCGAGGAACAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-2169s21c1
Sequence:CCGGCAAAGTTTCTGGGCAACAATTCTCGAGAATTGTTGCCCAGAAACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-608s21c1
Sequence:CCGGGAGAGCTTCTACCCAGTATTTCTCGAGAAATACTGGGTAGAAGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1404s21c1
Sequence:CCGGTTGTCTGCAATCGCATCTATTCTCGAGAATAGATGCGATTGCAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1014s21c1
Sequence:CCGGAGCACCTGCTGCGCTTCATTACTCGAGTAATGAAGCGCAGCAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033303
AMPD1 MISSION shRNA shRNA Plasmid DNA
adenosine monophosphate deaminase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1944s21c1
Sequence:CCGGACAGTCTGTTCCTCGAATATGCTCGAGCATATTCGAGGAACAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-2169s21c1
Sequence:CCGGCAAAGTTTCTGGGCAACAATTCTCGAGAATTGTTGCCCAGAAACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-608s21c1
Sequence:CCGGGAGAGCTTCTACCCAGTATTTCTCGAGAAATACTGGGTAGAAGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1404s21c1
Sequence:CCGGTTGTCTGCAATCGCATCTATTCTCGAGAATAGATGCGATTGCAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1014s21c1
Sequence:CCGGAGCACCTGCTGCGCTTCATTACTCGAGTAATGAAGCGCAGCAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033303
AMPD1 MISSION shRNA Lentiviral Transduction Particles
adenosine monophosphate deaminase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1944s21c1
Sequence:CCGGACAGTCTGTTCCTCGAATATGCTCGAGCATATTCGAGGAACAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-2169s21c1
Sequence:CCGGCAAAGTTTCTGGGCAACAATTCTCGAGAATTGTTGCCCAGAAACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-608s21c1
Sequence:CCGGGAGAGCTTCTACCCAGTATTTCTCGAGAAATACTGGGTAGAAGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1404s21c1
Sequence:CCGGTTGTCTGCAATCGCATCTATTCTCGAGAATAGATGCGATTGCAGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033303.2-1014s21c1
Sequence:CCGGAGCACCTGCTGCGCTTCATTACTCGAGTAATGAAGCGCAGCAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)