EMAIL THIS PAGE TO A FRIEND

AMPD2

adenosine monophosphate deaminase 2

76 Gene Product Result for
Gene ID:
Human(271) Summary: The protein encoded by this gene is important in purine metabolism by converting AMP to IMP. The encoded protein, which acts as a homotetramer, is one of three AMP deaminases found in mammals. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(109674) adenosine monophosphate deaminase 2
Rat(362015) adenosine monophosphate deaminase 2
Zebrafish(571355) adenosine monophosphate deaminase 2 (isoform L)
domestic cat(101090958) adenosine monophosphate deaminase 2
cow(514185) adenosine monophosphate deaminase 2
Horse(100061723) adenosine monophosphate deaminase 2
dog(479913) adenosine monophosphate deaminase 2
chicken(100858316) adenosine monophosphate deaminase 2
sheep(101107149) adenosine monophosphate deaminase 2
Domestic Rabbit(100340249) adenosine monophosphate deaminase 2
domestic guinea pig(100719930) adenosine monophosphate deaminase 2
naked mole-rat(101704709) adenosine monophosphate deaminase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004037 Rosetta Predictions human pricing
NM_139156 Rosetta Predictions human pricing
NM_203404 Rosetta Predictions human pricing
NM_001101681 Rosetta Predictions rat pricing
NM_028779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037450 predicted 2458
2 SASI_Hs01_00037451 predicted 2993
3 SASI_Hs01_00037452 predicted 994
4 SASI_Hs01_00037453 predicted 2353
5 SASI_Hs01_00037454 predicted 1740
6 SASI_Hs02_00336786 predicted 2398
7 SASI_Hs01_00037455 predicted 2079
8 SASI_Hs01_00037456 predicted 1899
9 SASI_Hs01_00037457 predicted 1414
10 SASI_Hs01_00037458 predicted 1887
11 SASI_Hs01_00037449 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092648 predicted 2282
2 SASI_Hs01_00092649 predicted 2814
3 SASI_Hs01_00092650 predicted 821
4 SASI_Hs01_00092651 predicted 2177
5 SASI_Hs01_00092652 predicted 1573
6 SASI_Hs02_00364164 predicted 2229
7 SASI_Hs01_00092653 predicted 1915
8 SASI_Hs01_00092654 predicted 1730
9 SASI_Hs01_00092655 predicted 1244
10 SASI_Hs01_00092656 predicted 1715
11 SASI_Hs01_00092647 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231621 predicted 1946
2 SASI_Hs01_00231622 predicted 2480
3 SASI_Hs01_00231623 predicted 480
4 SASI_Hs01_00231624 predicted 1839
5 SASI_Hs01_00231625 predicted 1233
6 SASI_Hs02_00373333 predicted 1891
7 SASI_Hs01_00231626 predicted 1579
8 SASI_Hs01_00231627 predicted 1387
9 SASI_Hs01_00231628 predicted 908
10 SASI_Hs01_00231629 predicted 1375
11 SASI_Hs01_00231620 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211374 predicted 532
2 SASI_Rn02_00211375 predicted 1327
3 SASI_Rn02_00211376 predicted 1774
4 SASI_Rn02_00211377 predicted 1871
5 SASI_Rn02_00211378 predicted 450
6 SASI_Rn02_00211379 predicted 1858
7 SASI_Rn02_00211380 predicted 1553
8 SASI_Rn02_00211381 predicted 2308
9 SASI_Rn02_00211382 predicted 227
10 SASI_Rn02_00211383 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091344 predicted 789
2 SASI_Mm01_00091345 predicted 2049
3 SASI_Mm01_00091346 predicted 804
4 SASI_Mm01_00091347 predicted 1599
5 SASI_Mm01_00091348 predicted 504
6 SASI_Mm01_00091349 predicted 2145
7 SASI_Mm01_00091350 predicted 911
8 SASI_Mm01_00091351 predicted 581
9 SASI_Mm01_00091352 predicted 2890
10 SASI_Mm01_00091353 predicted 2336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004037
AMPD2 MISSION shRNA Bacterial Glycerol Stock
adenosine monophosphate deaminase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-782s1c1
Sequence:CCGGGCACGTCTATGGATGGCAAATCTCGAGATTTGCCATCCATAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-1888s1c1
Sequence:CCGGCATCGCTTTGACAAGTTTAATCTCGAGATTAAACTTGTCAAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-1728s1c1
Sequence:CCGGGCGCTTCATCAAGCGGGCAATCTCGAGATTGCCCGCTTGATGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-629s1c1
Sequence:CCGGCCAAGGCCAAATATCCCTTTACTCGAGTAAAGGGATATTTGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-2162s1c1
Sequence:CCGGGCCTCTTTGATGTGTACCGTACTCGAGTACGGTACACATCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-998s21c1
Sequence:CCGGATGTGCTGGAACGGGAGTTTCCTCGAGGAAACTCCCGTTCCAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-1895s21c1
Sequence:CCGGGGGTATCTGGGAAGTACTTTGCTCGAGCAAAGTACTTCCCAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-2462s21c1
Sequence:CCGGTCATGCTGGCTGAGAACATTTCTCGAGAAATGTTCTCAGCCAGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004037
AMPD2 MISSION shRNA shRNA Plasmid DNA
adenosine monophosphate deaminase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-782s1c1
Sequence:CCGGGCACGTCTATGGATGGCAAATCTCGAGATTTGCCATCCATAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-1888s1c1
Sequence:CCGGCATCGCTTTGACAAGTTTAATCTCGAGATTAAACTTGTCAAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-1728s1c1
Sequence:CCGGGCGCTTCATCAAGCGGGCAATCTCGAGATTGCCCGCTTGATGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-629s1c1
Sequence:CCGGCCAAGGCCAAATATCCCTTTACTCGAGTAAAGGGATATTTGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-2162s1c1
Sequence:CCGGGCCTCTTTGATGTGTACCGTACTCGAGTACGGTACACATCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-998s21c1
Sequence:CCGGATGTGCTGGAACGGGAGTTTCCTCGAGGAAACTCCCGTTCCAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-1895s21c1
Sequence:CCGGGGGTATCTGGGAAGTACTTTGCTCGAGCAAAGTACTTCCCAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-2462s21c1
Sequence:CCGGTCATGCTGGCTGAGAACATTTCTCGAGAAATGTTCTCAGCCAGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004037
AMPD2 MISSION shRNA Lentiviral Transduction Particles
adenosine monophosphate deaminase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-782s1c1
Sequence:CCGGGCACGTCTATGGATGGCAAATCTCGAGATTTGCCATCCATAGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-1888s1c1
Sequence:CCGGCATCGCTTTGACAAGTTTAATCTCGAGATTAAACTTGTCAAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-1728s1c1
Sequence:CCGGGCGCTTCATCAAGCGGGCAATCTCGAGATTGCCCGCTTGATGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-629s1c1
Sequence:CCGGCCAAGGCCAAATATCCCTTTACTCGAGTAAAGGGATATTTGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004037.5-2162s1c1
Sequence:CCGGGCCTCTTTGATGTGTACCGTACTCGAGTACGGTACACATCAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-998s21c1
Sequence:CCGGATGTGCTGGAACGGGAGTTTCCTCGAGGAAACTCCCGTTCCAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-1895s21c1
Sequence:CCGGGGGTATCTGGGAAGTACTTTGCTCGAGCAAAGTACTTCCCAGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004037.6-2462s21c1
Sequence:CCGGTCATGCTGGCTGAGAACATTTCTCGAGAAATGTTCTCAGCCAGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028779
VALIDATED
AMPD2 MISSION shRNA Bacterial Glycerol Stock
adenosine monophosphate deaminase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-3037s1c1
Sequence:CCGGCCCATCTCAGAATTGTCAGAACTCGAGTTCTGACAATTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-2137s1c1
Sequence:CCGGCCTGTACTACACCTTCGCTAACTCGAGTTAGCGAAGGTGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028779.3-2152s1c1
Sequence:CCGGCGCTAACATGGCTATGTTGAACTCGAGTTCAACATAGCCATGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-502s1c1
Sequence:CCGGGCGCACGTCTATGGATGGCAACTCGAGTTGCCATCCATAGACGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-1595s1c1
Sequence:CCGGGCGGACAGGAATACCTTTCATCTCGAGATGAAAGGTATTCCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-1595s21c1
Sequence:CCGGGCGGACAGGAATACCTTTCATCTCGAGATGAAAGGTATTCCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028779.4-3037s21c1
Sequence:CCGGCCCATCTCAGAATTGTCAGAACTCGAGTTCTGACAATTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-502s21c1
Sequence:CCGGGCGCACGTCTATGGATGGCAACTCGAGTTGCCATCCATAGACGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-2152s21c1
Sequence:CCGGCGCTAACATGGCTATGTTGAACTCGAGTTCAACATAGCCATGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028779
VALIDATED
AMPD2 MISSION shRNA shRNA Plasmid DNA
adenosine monophosphate deaminase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-3037s1c1
Sequence:CCGGCCCATCTCAGAATTGTCAGAACTCGAGTTCTGACAATTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-2137s1c1
Sequence:CCGGCCTGTACTACACCTTCGCTAACTCGAGTTAGCGAAGGTGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028779.3-2152s1c1
Sequence:CCGGCGCTAACATGGCTATGTTGAACTCGAGTTCAACATAGCCATGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-502s1c1
Sequence:CCGGGCGCACGTCTATGGATGGCAACTCGAGTTGCCATCCATAGACGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-1595s1c1
Sequence:CCGGGCGGACAGGAATACCTTTCATCTCGAGATGAAAGGTATTCCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-1595s21c1
Sequence:CCGGGCGGACAGGAATACCTTTCATCTCGAGATGAAAGGTATTCCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028779.4-3037s21c1
Sequence:CCGGCCCATCTCAGAATTGTCAGAACTCGAGTTCTGACAATTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-502s21c1
Sequence:CCGGGCGCACGTCTATGGATGGCAACTCGAGTTGCCATCCATAGACGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-2152s21c1
Sequence:CCGGCGCTAACATGGCTATGTTGAACTCGAGTTCAACATAGCCATGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028779
VALIDATED
AMPD2 MISSION shRNA Lentiviral Transduction Particles
adenosine monophosphate deaminase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-3037s1c1
Sequence:CCGGCCCATCTCAGAATTGTCAGAACTCGAGTTCTGACAATTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-2137s1c1
Sequence:CCGGCCTGTACTACACCTTCGCTAACTCGAGTTAGCGAAGGTGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028779.3-2152s1c1
Sequence:CCGGCGCTAACATGGCTATGTTGAACTCGAGTTCAACATAGCCATGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-502s1c1
Sequence:CCGGGCGCACGTCTATGGATGGCAACTCGAGTTGCCATCCATAGACGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028779.3-1595s1c1
Sequence:CCGGGCGGACAGGAATACCTTTCATCTCGAGATGAAAGGTATTCCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-1595s21c1
Sequence:CCGGGCGGACAGGAATACCTTTCATCTCGAGATGAAAGGTATTCCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028779.4-3037s21c1
Sequence:CCGGCCCATCTCAGAATTGTCAGAACTCGAGTTCTGACAATTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-502s21c1
Sequence:CCGGGCGCACGTCTATGGATGGCAACTCGAGTTGCCATCCATAGACGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028779.4-2152s21c1
Sequence:CCGGCGCTAACATGGCTATGTTGAACTCGAGTTCAACATAGCCATGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks