EMAIL THIS PAGE TO A FRIEND

AMPD3

adenosine monophosphate deaminase 3

78 Gene Product Result for
UniProtKB ID: Q01432, A0AUX0, B7Z2S2, B7Z763, B7Z877
Gene ID:
Human(272) Summary: This gene encodes a member of the AMP deaminase gene family. The encoded protein is a highly regulated enzyme that catalyzes the hydrolytic deamination of adenosine monophosphate to inosine monophosphate, a branch point in the adenylate catabolic pathway. This gene encodes the erythrocyte (E) isoforms, whereas other family members encode isoforms that predominate in muscle (M) and liver (L) cells. Mutations in this gene lead to the clinically asymptomatic, autosomal recessive condition erythrocyte AMP deaminase deficiency. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
Mouse(11717) adenosine monophosphate deaminase 3
Rat(25095) adenosine monophosphate deaminase 3
naked mole-rat(101706263) adenosine monophosphate deaminase 3
domestic guinea pig(100728217) adenosine monophosphate deaminase 3
sheep(101103503) adenosine monophosphate deaminase 3
chicken(423041) adenosine monophosphate deaminase 3
cow(519803) adenosine monophosphate deaminase 3
Horse(100055812) adenosine monophosphate deaminase 3
domestic cat(101087346) adenosine monophosphate deaminase 3
dog(476851) adenosine monophosphate deaminase 3
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000480 Rosetta Predictions human pricing
NM_001025389 Rosetta Predictions human pricing
NM_001025390 Rosetta Predictions human pricing
NM_031544 Rosetta Predictions rat pricing
NM_009667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166108 predicted 2574
2 SASI_Hs01_00166109 predicted 1786
3 SASI_Hs01_00166110 predicted 2218
4 SASI_Hs01_00166111 predicted 2622
5 SASI_Hs01_00166112 predicted 1255
6 SASI_Hs01_00166113 predicted 1797
7 SASI_Hs01_00166115 predicted 2652
8 SASI_Hs01_00166116 predicted 2635
9 SASI_Hs01_00166117 predicted 1232
10 SASI_Hs02_00302622 predicted 628
11 SASI_Hs01_00166114 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172009 predicted 2532
2 SASI_Hs01_00172010 predicted 1757
3 SASI_Hs01_00172011 predicted 2173
4 SASI_Hs01_00172012 predicted 2584
5 SASI_Hs01_00172013 predicted 1213
6 SASI_Hs01_00172014 predicted 1759
7 SASI_Hs01_00172016 predicted 2607
8 SASI_Hs01_00172017 predicted 2599
9 SASI_Hs01_00172018 predicted 1191
10 SASI_Hs02_00307455 predicted 593
11 SASI_Hs01_00172015 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181181 predicted 2670
2 SASI_Hs01_00181182 predicted 1887
3 SASI_Hs01_00181183 predicted 2318
4 SASI_Hs01_00181184 predicted 2727
5 SASI_Hs01_00181185 predicted 1354
6 SASI_Hs01_00181186 predicted 1901
7 SASI_Hs01_00181188 predicted 2751
8 SASI_Hs01_00181189 predicted 2732
9 SASI_Hs01_00181190 predicted 1326
10 SASI_Hs02_00307456 predicted 735
11 SASI_Hs01_00181187 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047473 predicted 227
2 SASI_Rn01_00047474 predicted 890
3 SASI_Rn01_00047475 predicted 340
4 SASI_Rn01_00047476 predicted 1393
5 SASI_Rn01_00047477 predicted 1564
6 SASI_Rn01_00047478 predicted 2058
7 SASI_Rn01_00047479 predicted 2042
8 SASI_Rn02_00264717 predicted 2082
9 SASI_Rn01_00047480 predicted 1990
10 SASI_Rn01_00047481 predicted 1979
11 SASI_Rn01_00047482 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193730 predicted 1955
2 SASI_Mm01_00193731 predicted 1742
3 SASI_Mm01_00193732 predicted 2241
4 SASI_Mm01_00193733 predicted 2352
5 SASI_Mm02_00316692 predicted 1718
6 SASI_Mm01_00193734 predicted 2648
7 SASI_Mm01_00193735 predicted 2496
8 SASI_Mm01_00193736 predicted 1947
9 SASI_Mm02_00316693 predicted 1149
10 SASI_Mm01_00193737 predicted 2425
11 SASI_Mm01_00193738 predicted 2156
12 SASI_Mm01_00193739 predicted 1128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009667
VALIDATED
AMPD3 MISSION shRNA Bacterial Glycerol Stock
adenosine monophosphate deaminase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-1954s21c1
Sequence:CCGGGCCCTATAGTTACTACCTGTACTCGAGTACAGGTAGTAACTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-970s21c1
Sequence:CCGGCGGAGGTGTTCTCTTTGTGTACTCGAGTACACAAAGAGAACACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-668s21c1
Sequence:CCGGCCCTATGCTATGCCTGAGTATCTCGAGATACTCAGGCATAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-569s21c1
Sequence:CCGGCCAACACAACAAGACTGGAAACTCGAGTTTCCAGTCTTGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-370s1c1
Sequence:CCGGCCCTATGCTATGCCTGAGTATCTCGAGATACTCAGGCATAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009667.1-672s1c1
Sequence:CCGGCGGAGGTGTTCTCTTTGTGTACTCGAGTACACAAAGAGAACACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-271s1c1
Sequence:CCGGCCAACACAACAAGACTGGAAACTCGAGTTTCCAGTCTTGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-1656s1c1
Sequence:CCGGGCCCTATAGTTACTACCTGTACTCGAGTACAGGTAGTAACTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009667.1-867s1c1
Sequence:CCGGGCTAAATGAAATGTCAGAGTTCTCGAGAACTCTGACATTTCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009667
VALIDATED
AMPD3 MISSION shRNA shRNA Plasmid DNA
adenosine monophosphate deaminase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-1954s21c1
Sequence:CCGGGCCCTATAGTTACTACCTGTACTCGAGTACAGGTAGTAACTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-970s21c1
Sequence:CCGGCGGAGGTGTTCTCTTTGTGTACTCGAGTACACAAAGAGAACACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-668s21c1
Sequence:CCGGCCCTATGCTATGCCTGAGTATCTCGAGATACTCAGGCATAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-569s21c1
Sequence:CCGGCCAACACAACAAGACTGGAAACTCGAGTTTCCAGTCTTGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-370s1c1
Sequence:CCGGCCCTATGCTATGCCTGAGTATCTCGAGATACTCAGGCATAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009667.1-672s1c1
Sequence:CCGGCGGAGGTGTTCTCTTTGTGTACTCGAGTACACAAAGAGAACACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-271s1c1
Sequence:CCGGCCAACACAACAAGACTGGAAACTCGAGTTTCCAGTCTTGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-1656s1c1
Sequence:CCGGGCCCTATAGTTACTACCTGTACTCGAGTACAGGTAGTAACTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009667.1-867s1c1
Sequence:CCGGGCTAAATGAAATGTCAGAGTTCTCGAGAACTCTGACATTTCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009667
VALIDATED
AMPD3 MISSION shRNA Lentiviral Transduction Particles
adenosine monophosphate deaminase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-1954s21c1
Sequence:CCGGGCCCTATAGTTACTACCTGTACTCGAGTACAGGTAGTAACTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-970s21c1
Sequence:CCGGCGGAGGTGTTCTCTTTGTGTACTCGAGTACACAAAGAGAACACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-668s21c1
Sequence:CCGGCCCTATGCTATGCCTGAGTATCTCGAGATACTCAGGCATAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009667.2-569s21c1
Sequence:CCGGCCAACACAACAAGACTGGAAACTCGAGTTTCCAGTCTTGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-370s1c1
Sequence:CCGGCCCTATGCTATGCCTGAGTATCTCGAGATACTCAGGCATAGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009667.1-672s1c1
Sequence:CCGGCGGAGGTGTTCTCTTTGTGTACTCGAGTACACAAAGAGAACACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-271s1c1
Sequence:CCGGCCAACACAACAAGACTGGAAACTCGAGTTTCCAGTCTTGTTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009667.1-1656s1c1
Sequence:CCGGGCCCTATAGTTACTACCTGTACTCGAGTACAGGTAGTAACTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009667.1-867s1c1
Sequence:CCGGGCTAAATGAAATGTCAGAGTTCTCGAGAACTCTGACATTTCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000480
VALIDATED
AMPD3 MISSION shRNA Bacterial Glycerol Stock
adenosine monophosphate deaminase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-4186s21c1
Sequence:CCGGATGCTATCTTACAGCTAATTACTCGAGTAATTAGCTGTAAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-2581s21c1
Sequence:CCGGATCCGGATGGCATTCCGATATCTCGAGATATCGGAATGCCATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-2282s21c1
Sequence:CCGGACAGTTTGTTCCTCGAATATTCTCGAGAATATTCGAGGAACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-1793s21c1
Sequence:CCGGCCCGGATTTATGACATATTTACTCGAGTAAATATGTCATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000480.2-768s21c1
Sequence:CCGGGGTCACCATCAGCGGAGATTACTCGAGTAATCTCCGCTGATGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000480.1-2589s1c1
Sequence:CCGGGCATTCCGATATGAGACCTTACTCGAGTAAGGTCTCATATCGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000480.1-432s1c1
Sequence:CCGGGCGGAGAAGGTGTTTGCTAAACTCGAGTTTAGCAAACACCTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000480.1-1792s1c1
Sequence:CCGGCCCGGATTTATGACATATTTACTCGAGTAAATATGTCATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_000480.1-1051s1c1
Sequence:CCGGGCATCCTCTTTGTGTATGATACTCGAGTATCATACACAAAGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000480.1-2204s1c1
Sequence:CCGGCCTCAAGAAGAGTCCGGTATTCTCGAGAATACCGGACTCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000480
VALIDATED
AMPD3 MISSION shRNA shRNA Plasmid DNA
adenosine monophosphate deaminase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-4186s21c1
Sequence:CCGGATGCTATCTTACAGCTAATTACTCGAGTAATTAGCTGTAAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-2581s21c1
Sequence:CCGGATCCGGATGGCATTCCGATATCTCGAGATATCGGAATGCCATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-2282s21c1
Sequence:CCGGACAGTTTGTTCCTCGAATATTCTCGAGAATATTCGAGGAACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-1793s21c1
Sequence:CCGGCCCGGATTTATGACATATTTACTCGAGTAAATATGTCATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000480.2-768s21c1
Sequence:CCGGGGTCACCATCAGCGGAGATTACTCGAGTAATCTCCGCTGATGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000480.1-2589s1c1
Sequence:CCGGGCATTCCGATATGAGACCTTACTCGAGTAAGGTCTCATATCGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000480.1-432s1c1
Sequence:CCGGGCGGAGAAGGTGTTTGCTAAACTCGAGTTTAGCAAACACCTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000480.1-1792s1c1
Sequence:CCGGCCCGGATTTATGACATATTTACTCGAGTAAATATGTCATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_000480.1-1051s1c1
Sequence:CCGGGCATCCTCTTTGTGTATGATACTCGAGTATCATACACAAAGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000480.1-2204s1c1
Sequence:CCGGCCTCAAGAAGAGTCCGGTATTCTCGAGAATACCGGACTCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000480
VALIDATED
AMPD3 MISSION shRNA Lentiviral Transduction Particles
adenosine monophosphate deaminase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-4186s21c1
Sequence:CCGGATGCTATCTTACAGCTAATTACTCGAGTAATTAGCTGTAAGATAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-2581s21c1
Sequence:CCGGATCCGGATGGCATTCCGATATCTCGAGATATCGGAATGCCATCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-2282s21c1
Sequence:CCGGACAGTTTGTTCCTCGAATATTCTCGAGAATATTCGAGGAACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000480.2-1793s21c1
Sequence:CCGGCCCGGATTTATGACATATTTACTCGAGTAAATATGTCATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000480.2-768s21c1
Sequence:CCGGGGTCACCATCAGCGGAGATTACTCGAGTAATCTCCGCTGATGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000480.1-2589s1c1
Sequence:CCGGGCATTCCGATATGAGACCTTACTCGAGTAAGGTCTCATATCGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000480.1-432s1c1
Sequence:CCGGGCGGAGAAGGTGTTTGCTAAACTCGAGTTTAGCAAACACCTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000480.1-1792s1c1
Sequence:CCGGCCCGGATTTATGACATATTTACTCGAGTAAATATGTCATAAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_000480.1-1051s1c1
Sequence:CCGGGCATCCTCTTTGTGTATGATACTCGAGTATCATACACAAAGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_000480.1-2204s1c1
Sequence:CCGGCCTCAAGAAGAGTCCGGTATTCTCGAGAATACCGGACTCTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks