EMAIL THIS PAGE TO A FRIEND

AMPH

amphiphysin

Synonyms: AMPH1
Gene ID:
Human(273) Summary: This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
Mouse(218038) amphiphysin
Rat(60668) amphiphysin
Zebrafish(393804) amphiphysin
chicken(420761) amphiphysin
cow(614722) amphiphysin
Horse(100062724) amphiphysin
dog(475877) amphiphysin
fruit fly(36383) Amphiphysin
sheep(101122270) amphiphysin
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001635 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001635 Rosetta Predictions human pricing
NM_139316 Rosetta Predictions human pricing
NM_022217 Rosetta Predictions rat pricing
NM_175007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163986 predicted 2067
2 SASI_Hs01_00163988 predicted 244
3 SASI_Hs01_00163989 predicted 621
4 SASI_Hs01_00163990 predicted 1680
5 SASI_Hs01_00163991 predicted 603
6 SASI_Hs01_00163992 predicted 550
7 SASI_Hs02_00332221 predicted 2025
8 SASI_Hs01_00163993 predicted 652
9 SASI_Hs01_00163994 predicted 1003
10 SASI_Hs01_00163995 predicted 327
11 SASI_Hs01_00163987 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090955 predicted 1948
2 SASI_Hs01_00090957 predicted 250
3 SASI_Hs01_00090958 predicted 624
4 SASI_Hs01_00090959 predicted 1551
5 SASI_Hs01_00090960 predicted 599
6 SASI_Hs01_00090961 predicted 547
7 SASI_Hs02_00364285 predicted 1892
8 SASI_Hs01_00090962 predicted 645
9 SASI_Hs01_00090963 predicted 1003
10 SASI_Hs01_00090964 predicted 325
11 SASI_Hs01_00090956 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035222 predicted 1241
2 SASI_Rn01_00035223 predicted 552
3 SASI_Rn01_00035224 predicted 202
4 SASI_Rn01_00035225 predicted 555
5 SASI_Rn01_00035226 predicted 643
6 SASI_Rn01_00035227 predicted 1142
7 SASI_Rn02_00262975 predicted 1131
8 SASI_Rn01_00035228 predicted 1000
9 SASI_Rn01_00035229 predicted 480
10 SASI_Rn01_00035230 predicted 582
11 SASI_Rn01_00035221 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049793 predicted 1938
2 SASI_Mm01_00049794 predicted 637
3 SASI_Mm01_00049796 predicted 1042
4 SASI_Mm01_00049797 predicted 1060
5 SASI_Mm02_00345572 predicted 990
6 SASI_Mm01_00049798 predicted 2188
7 SASI_Mm01_00049799 predicted 345
8 SASI_Mm01_00049800 predicted 481
9 SASI_Mm02_00345573 predicted 722
10 SASI_Mm01_00049801 predicted 2157
11 SASI_Mm01_00049795 predicted 1231
12 SASI_Mm01_00049802 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001635
VALIDATED
AMPH MISSION shRNA Bacterial Glycerol Stock
amphiphysin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-1320s1c1
Sequence:CCGGCCAGAGTATGATCTGCAACTTCTCGAGAAGTTGCAGATCATACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-887s1c1
Sequence:CCGGCGACAGCAAGTCCAAATCATACTCGAGTATGATTTGGACTTGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-1982s1c1
Sequence:CCGGCTGATGAACTTACCTTACAAACTCGAGTTTGTAAGGTAAGTTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001635.2-562s1c1
Sequence:CCGGCGAATCTCTAAGGCAGAAGAACTCGAGTTCTTCTGCCTTAGAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001635.2-2798s1c1
Sequence:CCGGGCTCTTATTCTGTCTGGCATTCTCGAGAATGCCAGACAGAATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-445s21c1
Sequence:GTACCGGGGGCAATTTCCTGACATAAAGCTCGAGCTTTATGTCAGGAAATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001635.2-240s21c1
Sequence:GTACCGGGCGAGAACTCCGAGGATATTTCTCGAGAAATATCCTCGGAGTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-305s21c1
Sequence:GTACCGGAGTCGCTGCATGAAGTCTATGCTCGAGCATAGACTTCATGCAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-600s21c1
Sequence:GTACCGGGAAAGTGTTTGAAGAGTTTAACTCGAGTTAAACTCTTCAAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-1685s21c1
Sequence:GTACCGGTCATTCCTTCGGTGGTCATAGCTCGAGCTATGACCACCGAAGGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-2099s21c1
Sequence:GTACCGGGAGACCTTGCCACCTACAAAGCTCGAGCTTTGTAGGTGGCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001635
VALIDATED
AMPH MISSION shRNA shRNA Plasmid DNA
amphiphysin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-1320s1c1
Sequence:CCGGCCAGAGTATGATCTGCAACTTCTCGAGAAGTTGCAGATCATACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-887s1c1
Sequence:CCGGCGACAGCAAGTCCAAATCATACTCGAGTATGATTTGGACTTGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-1982s1c1
Sequence:CCGGCTGATGAACTTACCTTACAAACTCGAGTTTGTAAGGTAAGTTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001635.2-562s1c1
Sequence:CCGGCGAATCTCTAAGGCAGAAGAACTCGAGTTCTTCTGCCTTAGAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001635.2-2798s1c1
Sequence:CCGGGCTCTTATTCTGTCTGGCATTCTCGAGAATGCCAGACAGAATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-445s21c1
Sequence:GTACCGGGGGCAATTTCCTGACATAAAGCTCGAGCTTTATGTCAGGAAATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001635.2-240s21c1
Sequence:GTACCGGGCGAGAACTCCGAGGATATTTCTCGAGAAATATCCTCGGAGTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-305s21c1
Sequence:GTACCGGAGTCGCTGCATGAAGTCTATGCTCGAGCATAGACTTCATGCAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-600s21c1
Sequence:GTACCGGGAAAGTGTTTGAAGAGTTTAACTCGAGTTAAACTCTTCAAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-1685s21c1
Sequence:GTACCGGTCATTCCTTCGGTGGTCATAGCTCGAGCTATGACCACCGAAGGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-2099s21c1
Sequence:GTACCGGGAGACCTTGCCACCTACAAAGCTCGAGCTTTGTAGGTGGCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001635
VALIDATED
AMPH MISSION shRNA Lentiviral Transduction Particles
amphiphysin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-1320s1c1
Sequence:CCGGCCAGAGTATGATCTGCAACTTCTCGAGAAGTTGCAGATCATACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-887s1c1
Sequence:CCGGCGACAGCAAGTCCAAATCATACTCGAGTATGATTTGGACTTGCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001635.2-1982s1c1
Sequence:CCGGCTGATGAACTTACCTTACAAACTCGAGTTTGTAAGGTAAGTTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001635.2-562s1c1
Sequence:CCGGCGAATCTCTAAGGCAGAAGAACTCGAGTTCTTCTGCCTTAGAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001635.2-2798s1c1
Sequence:CCGGGCTCTTATTCTGTCTGGCATTCTCGAGAATGCCAGACAGAATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-445s21c1
Sequence:GTACCGGGGGCAATTTCCTGACATAAAGCTCGAGCTTTATGTCAGGAAATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001635.2-240s21c1
Sequence:GTACCGGGCGAGAACTCCGAGGATATTTCTCGAGAAATATCCTCGGAGTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-305s21c1
Sequence:GTACCGGAGTCGCTGCATGAAGTCTATGCTCGAGCATAGACTTCATGCAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-600s21c1
Sequence:GTACCGGGAAAGTGTTTGAAGAGTTTAACTCGAGTTAAACTCTTCAAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-1685s21c1
Sequence:GTACCGGTCATTCCTTCGGTGGTCATAGCTCGAGCTATGACCACCGAAGGAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001635.2-2099s21c1
Sequence:GTACCGGGAGACCTTGCCACCTACAAAGCTCGAGCTTTGTAGGTGGCAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175007
AMPH MISSION shRNA Bacterial Glycerol Stock
amphiphysin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175007.1-2980s1c1
Sequence:CCGGGCAGTCATCATTCCTGCCTTTCTCGAGAAAGGCAGGAATGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-1948s1c1
Sequence:CCGGCTGATGAACTTAACCTACAAACTCGAGTTTGTAGGTTAAGTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-885s1c1
Sequence:CCGGGCTAGTCCCAACCACACATTACTCGAGTAATGTGTGGTTGGGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-603s1c1
Sequence:CCGGGAAGAGTTCAATGTTGACTTACTCGAGTAAGTCAACATTGAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-279s1c1
Sequence:CCGGGCCTCAATGAAGCTCACTGAACTCGAGTTCAGTGAGCTTCATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175007.1-1940s21c1
Sequence:GTACCGGAGCGAACTCTGATGAACTTAACTCGAGTTAAGTTCATCAGAGTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175007.1-624s21c1
Sequence:GTACCGGCAAGAAGAGTTGCCGTCATTGCTCGAGCAATGACGGCAACTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175007
AMPH MISSION shRNA shRNA Plasmid DNA
amphiphysin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175007.1-2980s1c1
Sequence:CCGGGCAGTCATCATTCCTGCCTTTCTCGAGAAAGGCAGGAATGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-1948s1c1
Sequence:CCGGCTGATGAACTTAACCTACAAACTCGAGTTTGTAGGTTAAGTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-885s1c1
Sequence:CCGGGCTAGTCCCAACCACACATTACTCGAGTAATGTGTGGTTGGGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-603s1c1
Sequence:CCGGGAAGAGTTCAATGTTGACTTACTCGAGTAAGTCAACATTGAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-279s1c1
Sequence:CCGGGCCTCAATGAAGCTCACTGAACTCGAGTTCAGTGAGCTTCATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175007.1-1940s21c1
Sequence:GTACCGGAGCGAACTCTGATGAACTTAACTCGAGTTAAGTTCATCAGAGTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175007.1-624s21c1
Sequence:GTACCGGCAAGAAGAGTTGCCGTCATTGCTCGAGCAATGACGGCAACTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175007
AMPH MISSION shRNA Lentiviral Transduction Particles
amphiphysin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175007.1-2980s1c1
Sequence:CCGGGCAGTCATCATTCCTGCCTTTCTCGAGAAAGGCAGGAATGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-1948s1c1
Sequence:CCGGCTGATGAACTTAACCTACAAACTCGAGTTTGTAGGTTAAGTTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-885s1c1
Sequence:CCGGGCTAGTCCCAACCACACATTACTCGAGTAATGTGTGGTTGGGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-603s1c1
Sequence:CCGGGAAGAGTTCAATGTTGACTTACTCGAGTAAGTCAACATTGAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175007.1-279s1c1
Sequence:CCGGGCCTCAATGAAGCTCACTGAACTCGAGTTCAGTGAGCTTCATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175007.1-1940s21c1
Sequence:GTACCGGAGCGAACTCTGATGAACTTAACTCGAGTTAAGTTCATCAGAGTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175007.1-624s21c1
Sequence:GTACCGGCAAGAAGAGTTGCCGTCATTGCTCGAGCAATGACGGCAACTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks