EMAIL THIS PAGE TO A FRIEND

AMT

aminomethyltransferase

101 Gene Product Result for
Synonyms: GCE GCST GCVT NKH
UniProtKB ID: P48728, A8K3I5, B4DE61, B4DJQ0, E9PBG1, Q96IG6
Gene ID:
Human(275) Summary: This gene encodes one of four critical components of the glycine cleavage system. Mutations in this gene have been associated with glycine encephalopathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(434437) aminomethyltransferase
Rat(306586) aminomethyltransferase
Zebrafish(450000) aminomethyltransferase
dog(484770) aminomethyltransferase
Horse(100053253) aminomethyltransferase
cow(280719) aminomethyltransferase
domestic cat(101084781) aminomethyltransferase
chicken(395566) aminomethyltransferase
naked mole-rat(101711434) aminomethyltransferase
domestic guinea pig(100729673) aminomethyltransferase
sheep(101104276) aminomethyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000481 Rosetta Predictions human pricing
NM_001014004 Rosetta Predictions rat pricing
NM_001013814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013351 predicted 1298
2 SASI_Hs01_00013352 predicted 494
3 SASI_Hs02_00302623 predicted 353
4 SASI_Hs01_00013354 predicted 954
5 SASI_Hs01_00013355 predicted 1145
6 SASI_Hs01_00013356 predicted 1240
7 SASI_Hs01_00013357 predicted 1331
8 SASI_Hs01_00013358 predicted 396
9 SASI_Hs01_00013359 predicted 1223
10 SASI_Hs01_00013360 predicted 1209
11 SASI_Hs01_00013353 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120065 predicted 1368
2 SASI_Rn01_00120066 predicted 998
3 SASI_Rn01_00120067 predicted 1436
4 SASI_Rn01_00120068 predicted 1341
5 SASI_Rn01_00120069 predicted 973
6 SASI_Rn01_00120071 predicted 1338
7 SASI_Rn01_00120072 predicted 1279
8 SASI_Rn02_00201374 predicted 1207
9 SASI_Rn01_00120073 predicted 1500
10 SASI_Rn01_00120074 predicted 365
11 SASI_Rn01_00120070 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099455 predicted 734
2 SASI_Mm01_00099457 predicted 775
3 SASI_Mm01_00099458 predicted 230
4 SASI_Mm01_00099459 predicted 1092
5 SASI_Mm01_00099460 predicted 453
6 SASI_Mm01_00099461 predicted 994
7 SASI_Mm01_00099462 predicted 335
8 SASI_Mm02_00287390 predicted 1044
9 SASI_Mm01_00099463 predicted 790
10 SASI_Mm01_00099464 predicted 685
11 SASI_Mm01_00099456 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000481
AMT MISSION shRNA Bacterial Glycerol Stock
aminomethyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-377s21c1
Sequence:CCGGATATGCTGCAGACCAAGATACCTCGAGGTATCTTGGTCTGCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-512s21c1
Sequence:CCGGATGACTTGATTGTAACCAATACTCGAGTATTGGTTACAATCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-1202s21c1
Sequence:CCGGAGAATGTGGCGATGGGTTATGCTCGAGCATAACCCATCGCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-1311s21c1
Sequence:CCGGTGTGCCCACAAACTACTATACCTCGAGGTATAGTAGTTTGTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000481.2-1726s21c1
Sequence:CCGGCACATTGCAAAGGGTAATAACCTCGAGGTTATTACCCTTTGCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-359s1c1
Sequence:CCGGCGCTCTTTGACGTGTCTCATACTCGAGTATGAGACACGTCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-191s1c1
Sequence:CCGGCCTTGTGTCGTCCACTTAGTTCTCGAGAACTAAGTGGACGACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-1314s1c1
Sequence:CCGGGCCCACAAACTACTATACCCTCTCGAGAGGGTATAGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-855s1c1
Sequence:CCGGCCTGGCAACAGCTATTCTGAACTCGAGTTCAGAATAGCTGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-1154s1c1
Sequence:CCGGCCAAGATTGGTACTGTGACTACTCGAGTAGTCACAGTACCAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000481
AMT MISSION shRNA shRNA Plasmid DNA
aminomethyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-377s21c1
Sequence:CCGGATATGCTGCAGACCAAGATACCTCGAGGTATCTTGGTCTGCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-512s21c1
Sequence:CCGGATGACTTGATTGTAACCAATACTCGAGTATTGGTTACAATCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-1202s21c1
Sequence:CCGGAGAATGTGGCGATGGGTTATGCTCGAGCATAACCCATCGCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-1311s21c1
Sequence:CCGGTGTGCCCACAAACTACTATACCTCGAGGTATAGTAGTTTGTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000481.2-1726s21c1
Sequence:CCGGCACATTGCAAAGGGTAATAACCTCGAGGTTATTACCCTTTGCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-359s1c1
Sequence:CCGGCGCTCTTTGACGTGTCTCATACTCGAGTATGAGACACGTCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-191s1c1
Sequence:CCGGCCTTGTGTCGTCCACTTAGTTCTCGAGAACTAAGTGGACGACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-1314s1c1
Sequence:CCGGGCCCACAAACTACTATACCCTCTCGAGAGGGTATAGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-855s1c1
Sequence:CCGGCCTGGCAACAGCTATTCTGAACTCGAGTTCAGAATAGCTGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-1154s1c1
Sequence:CCGGCCAAGATTGGTACTGTGACTACTCGAGTAGTCACAGTACCAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000481
AMT MISSION shRNA Lentiviral Transduction Particles
aminomethyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-377s21c1
Sequence:CCGGATATGCTGCAGACCAAGATACCTCGAGGTATCTTGGTCTGCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-512s21c1
Sequence:CCGGATGACTTGATTGTAACCAATACTCGAGTATTGGTTACAATCAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-1202s21c1
Sequence:CCGGAGAATGTGGCGATGGGTTATGCTCGAGCATAACCCATCGCCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000481.2-1311s21c1
Sequence:CCGGTGTGCCCACAAACTACTATACCTCGAGGTATAGTAGTTTGTGGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000481.2-1726s21c1
Sequence:CCGGCACATTGCAAAGGGTAATAACCTCGAGGTTATTACCCTTTGCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-359s1c1
Sequence:CCGGCGCTCTTTGACGTGTCTCATACTCGAGTATGAGACACGTCAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-191s1c1
Sequence:CCGGCCTTGTGTCGTCCACTTAGTTCTCGAGAACTAAGTGGACGACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-1314s1c1
Sequence:CCGGGCCCACAAACTACTATACCCTCTCGAGAGGGTATAGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-855s1c1
Sequence:CCGGCCTGGCAACAGCTATTCTGAACTCGAGTTCAGAATAGCTGTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000481.2-1154s1c1
Sequence:CCGGCCAAGATTGGTACTGTGACTACTCGAGTAGTCACAGTACCAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013814
AMT MISSION shRNA Bacterial Glycerol Stock
aminomethyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-1095s1c1
Sequence:CCGGGCGATGGGTTATGTGCCATTTCTCGAGAAATGGCACATAACCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-740s1c1
Sequence:CCGGCTTGGCAACTACTCTGTTGAACTCGAGTTCAACAGAGTAGTTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-350s1c1
Sequence:CCGGCCAGGGAACACTCTCTTTGTTCTCGAGAACAAAGAGAGTGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-429s1c1
Sequence:CCGGCACCTGTATGTAGTATCCAATCTCGAGATTGGATACTACATACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-123s1c1
Sequence:CCGGCCACTCTATGACTTCCACCTACTCGAGTAGGTGGAAGTCATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013814
AMT MISSION shRNA shRNA Plasmid DNA
aminomethyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-1095s1c1
Sequence:CCGGGCGATGGGTTATGTGCCATTTCTCGAGAAATGGCACATAACCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-740s1c1
Sequence:CCGGCTTGGCAACTACTCTGTTGAACTCGAGTTCAACAGAGTAGTTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-350s1c1
Sequence:CCGGCCAGGGAACACTCTCTTTGTTCTCGAGAACAAAGAGAGTGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-429s1c1
Sequence:CCGGCACCTGTATGTAGTATCCAATCTCGAGATTGGATACTACATACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-123s1c1
Sequence:CCGGCCACTCTATGACTTCCACCTACTCGAGTAGGTGGAAGTCATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013814
AMT MISSION shRNA Lentiviral Transduction Particles
aminomethyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-1095s1c1
Sequence:CCGGGCGATGGGTTATGTGCCATTTCTCGAGAAATGGCACATAACCCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-740s1c1
Sequence:CCGGCTTGGCAACTACTCTGTTGAACTCGAGTTCAACAGAGTAGTTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-350s1c1
Sequence:CCGGCCAGGGAACACTCTCTTTGTTCTCGAGAACAAAGAGAGTGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-429s1c1
Sequence:CCGGCACCTGTATGTAGTATCCAATCTCGAGATTGGATACTACATACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013814.1-123s1c1
Sequence:CCGGCCACTCTATGACTTCCACCTACTCGAGTAGGTGGAAGTCATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks