EMAIL THIS PAGE TO A FRIEND

AMTN

amelotin

82 Gene Product Result for
Synonyms: UNQ689
UniProtKB ID: Q6UX39, Q0P503, Q0P506
Gene ID:
Human(401138) Summary: The mineralized portions of teeth, the dentin and enamel, are formed by mesenchyme-derived odontoblasts and epithelium-derived ameloblasts, respectively. As ameloblasts differentiate, they deposit specific proteins necessary for enamel formation, including amelogenin (AMELX; MIM 300391), enamelin (ENAM; MIM 606585), and ameloblastin (AMBN; MIM 601259), in the organic enamel matrix. Amelotin is specifically expressed in maturation-stage ameloblasts (Iwasaki et al., 2005 [PubMed 16304441]
Mouse(71421) amelotin
Rat(689404) amelotin
dog(611794) amelotin
cow(618393) amelotin
sheep(101102238) amelotin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048361 MISSION® esiRNA esiRNA human AMTN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_212557 Rosetta Predictions human pricing
NM_001044296 Rosetta Predictions rat pricing
XM_284166 Rosetta Predictions mouse pricing
XM_904684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020820 predicted 431
2 SASI_Hs01_00020821 predicted 735
3 SASI_Hs02_00374246 predicted 613
4 SASI_Hs01_00020824 predicted 278
5 SASI_Hs01_00020825 predicted 241
6 SASI_Hs02_00374247 predicted 195
7 SASI_Hs01_00020826 predicted 273
8 SASI_Hs01_00020827 predicted 703
9 SASI_Hs01_00020829 predicted 752
10 SASI_Hs02_00374248 predicted 711
11 SASI_Hs01_00020822 predicted 338
12 SASI_Hs01_00020823 predicted 202
13 SASI_Hs01_00020828 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205634 predicted 757
2 SASI_Rn02_00205635 predicted 694
3 SASI_Rn02_00205636 predicted 545
4 SASI_Rn02_00205637 predicted 611
5 SASI_Rn02_00205638 predicted 758
6 SASI_Rn02_00205639 predicted 385
7 SASI_Rn02_00205640 predicted 336
8 SASI_Rn02_00205641 predicted 237
9 SASI_Rn02_00205642 predicted 542
10 SASI_Rn02_00205643 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270836 predicted 424
2 SASI_Mm01_00270837 predicted 487
3 SASI_Mm01_00270838 predicted 332
4 SASI_Mm01_00270839 predicted 370
5 SASI_Mm01_00270840 predicted 387
6 SASI_Mm01_00270841 predicted 374
7 SASI_Mm01_00270842 predicted 445
8 SASI_Mm01_00270843 predicted 536
9 SASI_Mm01_00270844 predicted 509
10 SASI_Mm01_00270845 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431110 predicted 482
2 SASI_Mm02_00431111 predicted 335
3 SASI_Mm02_00431112 predicted 573
4 SASI_Mm02_00431113 predicted 372
5 SASI_Mm02_00431114 predicted 759
6 SASI_Mm02_00431115 predicted 383
7 SASI_Mm02_00431116 predicted 666
8 SASI_Mm02_00431117 predicted 536
9 SASI_Mm02_00431118 predicted 513
10 SASI_Mm02_00431119 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376323
AMTN MISSION shRNA Bacterial Glycerol Stock
amelotin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-463s1c1
Sequence:CCGGGCCTCATCATCCATTCCTTGTCTCGAGACAAGGAATGGATGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-433s1c1
Sequence:CCGGGCTCAGAGGAATTGCCACAAACTCGAGTTTGTGGCAATTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-213s1c1
Sequence:CCGGCAGCAGTCAAATCAGGTCTTTCTCGAGAAAGACCTGATTTGACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-691s1c1
Sequence:CCGGCCACAGAATCAGCAAATGGAACTCGAGTTCCATTTGCTGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_376323.1-747s1c1
Sequence:CCGGGCCTCGAATTTGGTGATACATCTCGAGATGTATCACCAAATTCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-252s1c1
Sequence:CCGGCCATTAACACAGATGCTCACACTCGAGTGTGAGCATCTGTGTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376323.1-744s1c1
Sequence:CCGGGCTGCCTCGAATTTGGTGATACTCGAGTATCACCAAATTCGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-519s1c1
Sequence:CCGGGCTAATCCAGATGTCCAGGATCTCGAGATCCTGGACATCTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-687s1c1
Sequence:CCGGGCCACCACAGAATCAGCAAATCTCGAGATTTGCTGATTCTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376323
AMTN MISSION shRNA shRNA Plasmid DNA
amelotin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-463s1c1
Sequence:CCGGGCCTCATCATCCATTCCTTGTCTCGAGACAAGGAATGGATGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-433s1c1
Sequence:CCGGGCTCAGAGGAATTGCCACAAACTCGAGTTTGTGGCAATTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-213s1c1
Sequence:CCGGCAGCAGTCAAATCAGGTCTTTCTCGAGAAAGACCTGATTTGACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-691s1c1
Sequence:CCGGCCACAGAATCAGCAAATGGAACTCGAGTTCCATTTGCTGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_376323.1-747s1c1
Sequence:CCGGGCCTCGAATTTGGTGATACATCTCGAGATGTATCACCAAATTCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-252s1c1
Sequence:CCGGCCATTAACACAGATGCTCACACTCGAGTGTGAGCATCTGTGTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376323.1-744s1c1
Sequence:CCGGGCTGCCTCGAATTTGGTGATACTCGAGTATCACCAAATTCGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-519s1c1
Sequence:CCGGGCTAATCCAGATGTCCAGGATCTCGAGATCCTGGACATCTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-687s1c1
Sequence:CCGGGCCACCACAGAATCAGCAAATCTCGAGATTTGCTGATTCTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376323
AMTN MISSION shRNA Lentiviral Transduction Particles
amelotin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-463s1c1
Sequence:CCGGGCCTCATCATCCATTCCTTGTCTCGAGACAAGGAATGGATGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-433s1c1
Sequence:CCGGGCTCAGAGGAATTGCCACAAACTCGAGTTTGTGGCAATTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-213s1c1
Sequence:CCGGCAGCAGTCAAATCAGGTCTTTCTCGAGAAAGACCTGATTTGACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-691s1c1
Sequence:CCGGCCACAGAATCAGCAAATGGAACTCGAGTTCCATTTGCTGATTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_376323.1-747s1c1
Sequence:CCGGGCCTCGAATTTGGTGATACATCTCGAGATGTATCACCAAATTCGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-252s1c1
Sequence:CCGGCCATTAACACAGATGCTCACACTCGAGTGTGAGCATCTGTGTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376323.1-744s1c1
Sequence:CCGGGCTGCCTCGAATTTGGTGATACTCGAGTATCACCAAATTCGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_376323.1-519s1c1
Sequence:CCGGGCTAATCCAGATGTCCAGGATCTCGAGATCCTGGACATCTGGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376323.1-687s1c1
Sequence:CCGGGCCACCACAGAATCAGCAAATCTCGAGATTTGCTGATTCTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027793
AMTN MISSION shRNA Bacterial Glycerol Stock
amelotin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027793.1-837s21c1
Sequence:CCGGTTGGGAGGTATAAAGTCTTTACTCGAGTAAAGACTTTATACCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-243s21c1
Sequence:CCGGCCATAAGTCTCATACCATTAACTCGAGTTAATGGTATGAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-515s21c1
Sequence:CCGGTCTGGTCAGGCAGGCACTAAACTCGAGTTTAGTGCCTGCCTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-380s21c1
Sequence:CCGGCCGCAGATGTTACCCATTATTCTCGAGAATAATGGGTAACATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-703s21c1
Sequence:CCGGCACCATAGATCCACCAAATAGCTCGAGCTATTTGGTGGATCTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027793
AMTN MISSION shRNA shRNA Plasmid DNA
amelotin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027793.1-837s21c1
Sequence:CCGGTTGGGAGGTATAAAGTCTTTACTCGAGTAAAGACTTTATACCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-243s21c1
Sequence:CCGGCCATAAGTCTCATACCATTAACTCGAGTTAATGGTATGAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-515s21c1
Sequence:CCGGTCTGGTCAGGCAGGCACTAAACTCGAGTTTAGTGCCTGCCTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-380s21c1
Sequence:CCGGCCGCAGATGTTACCCATTATTCTCGAGAATAATGGGTAACATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-703s21c1
Sequence:CCGGCACCATAGATCCACCAAATAGCTCGAGCTATTTGGTGGATCTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027793
AMTN MISSION shRNA Lentiviral Transduction Particles
amelotin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027793.1-837s21c1
Sequence:CCGGTTGGGAGGTATAAAGTCTTTACTCGAGTAAAGACTTTATACCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-243s21c1
Sequence:CCGGCCATAAGTCTCATACCATTAACTCGAGTTAATGGTATGAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-515s21c1
Sequence:CCGGTCTGGTCAGGCAGGCACTAAACTCGAGTTTAGTGCCTGCCTGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-380s21c1
Sequence:CCGGCCGCAGATGTTACCCATTATTCTCGAGAATAATGGGTAACATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027793.1-703s21c1
Sequence:CCGGCACCATAGATCCACCAAATAGCTCGAGCTATTTGGTGGATCTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks