EMAIL THIS PAGE TO A FRIEND

AMY1A

amylase, alpha 1A (salivary)

Synonyms: AMY1
UniProtKB ID: P04745, A6NJS5, A8K8H6, Q13763, Q5T083
Gene ID:
Human(276) Summary: Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the salivary gland. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Rat(24203) amylase, alpha 1A (salivary)
chicken(414139) amylase, alpha 1A; salivary
cow(281622) amylase, alpha 1A (salivary)
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004038 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008221 Rosetta Predictions human pricing
NM_004038 Rosetta Predictions human pricing
NM_001010970 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305379 predicted 908
2 SASI_Hs01_00104537 predicted 1360
3 SASI_Hs01_00104538 predicted 295
4 SASI_Hs01_00104539 predicted 443
5 SASI_Hs01_00104540 predicted 703
6 SASI_Hs01_00104541 predicted 331
7 SASI_Hs01_00104542 predicted 769
8 SASI_Hs01_00104543 predicted 1424
9 SASI_Hs01_00104544 predicted 890
10 SASI_Hs01_00104545 predicted 1433
11 SASI_Hs01_00104546 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336787 predicted 989
2 SASI_Hs01_00126878 predicted 1440
3 SASI_Hs01_00126879 predicted 371
4 SASI_Hs01_00126880 predicted 517
5 SASI_Hs01_00126881 predicted 788
6 SASI_Hs01_00126882 predicted 417
7 SASI_Hs01_00126883 predicted 852
8 SASI_Hs01_00126884 predicted 1503
9 SASI_Hs01_00126885 predicted 978
10 SASI_Hs01_00126886 predicted 1523
11 SASI_Hs01_00126887 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032144 predicted 502
2 SASI_Rn02_00199842 predicted 464
3 SASI_Rn01_00032145 predicted 1059
4 SASI_Rn01_00032146 predicted 1041
5 SASI_Rn01_00032147 predicted 646
6 SASI_Rn01_00032148 predicted 392
7 SASI_Rn01_00032149 predicted 1385
8 SASI_Rn01_00032150 predicted 199
9 SASI_Rn01_00032153 predicted 494
10 SASI_Rn02_00199843 predicted 835
11 SASI_Rn01_00032151 predicted 456
12 SASI_Rn01_00032152 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004038
AMY1A MISSION shRNA Bacterial Glycerol Stock
amylase, alpha 1A (salivary)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-937s1c1
Sequence:CCGGCGGAAGGTAGTAAACCTTTCACTCGAGTGAAAGGTTTACTACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-1291s1c1
Sequence:CCGGGCTACCGTTGGCCAAGATATTCTCGAGAATATCTTGGCCAACGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-342s1c1
Sequence:CCGGGCTCTTGAATGTGAGCGATATCTCGAGATATCGCTCACATTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-1347s1c1
Sequence:CCGGCCACCAAATGATAATGGAGTACTCGAGTACTCCATTATCATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-794s1c1
Sequence:CCGGGCGTTCTAAGATTGCCGAATACTCGAGTATTCGGCAATCTTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004038.3-525s21c1
Sequence:CCGGACCAACCAGTTAGCTATAAATCTCGAGATTTATAGCTAACTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004038
AMY1A MISSION shRNA shRNA Plasmid DNA
amylase, alpha 1A (salivary)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-937s1c1
Sequence:CCGGCGGAAGGTAGTAAACCTTTCACTCGAGTGAAAGGTTTACTACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-1291s1c1
Sequence:CCGGGCTACCGTTGGCCAAGATATTCTCGAGAATATCTTGGCCAACGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-342s1c1
Sequence:CCGGGCTCTTGAATGTGAGCGATATCTCGAGATATCGCTCACATTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-1347s1c1
Sequence:CCGGCCACCAAATGATAATGGAGTACTCGAGTACTCCATTATCATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-794s1c1
Sequence:CCGGGCGTTCTAAGATTGCCGAATACTCGAGTATTCGGCAATCTTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004038.3-525s21c1
Sequence:CCGGACCAACCAGTTAGCTATAAATCTCGAGATTTATAGCTAACTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004038
AMY1A MISSION shRNA Lentiviral Transduction Particles
amylase, alpha 1A (salivary)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-937s1c1
Sequence:CCGGCGGAAGGTAGTAAACCTTTCACTCGAGTGAAAGGTTTACTACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-1291s1c1
Sequence:CCGGGCTACCGTTGGCCAAGATATTCTCGAGAATATCTTGGCCAACGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-342s1c1
Sequence:CCGGGCTCTTGAATGTGAGCGATATCTCGAGATATCGCTCACATTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-1347s1c1
Sequence:CCGGCCACCAAATGATAATGGAGTACTCGAGTACTCCATTATCATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004038.2-794s1c1
Sequence:CCGGGCGTTCTAAGATTGCCGAATACTCGAGTATTCGGCAATCTTAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004038.3-525s21c1
Sequence:CCGGACCAACCAGTTAGCTATAAATCTCGAGATTTATAGCTAACTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks