EMAIL THIS PAGE TO A FRIEND

AMY1B

amylase, alpha 1B (salivary)

15 Gene Product Result for
Synonyms: AMY1
Species: Human AMY1B(277)
Gene ID:
Human(277) Summary: Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the salivary gland. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008218 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008218 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305375 predicted 968
2 SASI_Hs01_00165766 predicted 1417
3 SASI_Hs01_00165767 predicted 347
4 SASI_Hs01_00165768 predicted 500
5 SASI_Hs01_00165769 predicted 765
6 SASI_Hs01_00165770 predicted 394
7 SASI_Hs01_00165771 predicted 835
8 SASI_Hs01_00165772 predicted 1479
9 SASI_Hs01_00165773 predicted 950
10 SASI_Hs01_00165774 predicted 1494
11 SASI_Hs01_00165775 predicted 1067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008218
AMY1B MISSION shRNA Bacterial Glycerol Stock
amylase, alpha 1B (salivary)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-501s21c1
Sequence:CCGGTACCAACCAGTTAGCTATAAACTCGAGTTTATAGCTAACTGGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-844s21c1
Sequence:CCGGGTTCTAAGATTGCCGAATATACTCGAGTATATTCGGCAATCTTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-978s21c1
Sequence:CCGGTGGTTCCCGGAAGGTAGTAAACTCGAGTTTACTACCTTCCGGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-393s21c1
Sequence:CCGGCTTGAATGTGAGCGATATTTACTCGAGTAAATATCGCTCACATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-1313s21c1
Sequence:CCGGTTATGGATTTACACGAGTAATCTCGAGATTACTCGTGTAAATCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008218.1-896s1c1
Sequence:CCGGGTTCAGAATTGATGCTTCCAACTCGAGTTGGAAGCATCAATTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008218.1-1493s1c1
Sequence:CCGGGAACATGGTTAATTTCCGCAACTCGAGTTGCGGAAATTAACCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008218
AMY1B MISSION shRNA shRNA Plasmid DNA
amylase, alpha 1B (salivary)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-501s21c1
Sequence:CCGGTACCAACCAGTTAGCTATAAACTCGAGTTTATAGCTAACTGGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-844s21c1
Sequence:CCGGGTTCTAAGATTGCCGAATATACTCGAGTATATTCGGCAATCTTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-978s21c1
Sequence:CCGGTGGTTCCCGGAAGGTAGTAAACTCGAGTTTACTACCTTCCGGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-393s21c1
Sequence:CCGGCTTGAATGTGAGCGATATTTACTCGAGTAAATATCGCTCACATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-1313s21c1
Sequence:CCGGTTATGGATTTACACGAGTAATCTCGAGATTACTCGTGTAAATCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008218.1-896s1c1
Sequence:CCGGGTTCAGAATTGATGCTTCCAACTCGAGTTGGAAGCATCAATTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008218.1-1493s1c1
Sequence:CCGGGAACATGGTTAATTTCCGCAACTCGAGTTGCGGAAATTAACCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008218
AMY1B MISSION shRNA Lentiviral Transduction Particles
amylase, alpha 1B (salivary)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-501s21c1
Sequence:CCGGTACCAACCAGTTAGCTATAAACTCGAGTTTATAGCTAACTGGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-844s21c1
Sequence:CCGGGTTCTAAGATTGCCGAATATACTCGAGTATATTCGGCAATCTTAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-978s21c1
Sequence:CCGGTGGTTCCCGGAAGGTAGTAAACTCGAGTTTACTACCTTCCGGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-393s21c1
Sequence:CCGGCTTGAATGTGAGCGATATTTACTCGAGTAAATATCGCTCACATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008218.1-1313s21c1
Sequence:CCGGTTATGGATTTACACGAGTAATCTCGAGATTACTCGTGTAAATCCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008218.1-896s1c1
Sequence:CCGGGTTCAGAATTGATGCTTCCAACTCGAGTTGGAAGCATCAATTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008218.1-1493s1c1
Sequence:CCGGGAACATGGTTAATTTCCGCAACTCGAGTTGCGGAAATTAACCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks