EMAIL THIS PAGE TO A FRIEND

AMY1C

amylase, alpha 1C (salivary)

17 Gene Product Result for
Synonyms: AMY1
Species: Human AMY1C(278)
Gene ID:
Human(278) Summary: Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the salivary gland. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK009 Amylase Activity Assay Kit sufficient for 100 colorimetric tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008219 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305376 predicted 988
2 SASI_Hs01_00117728 predicted 1439
3 SASI_Hs01_00117729 predicted 379
4 SASI_Hs01_00117730 predicted 524
5 SASI_Hs01_00117731 predicted 790
6 SASI_Hs01_00117732 predicted 414
7 SASI_Hs01_00117733 predicted 855
8 SASI_Hs01_00117734 predicted 1508
9 SASI_Hs01_00117735 predicted 969
10 SASI_Hs01_00117736 predicted 1515
11 SASI_Hs01_00117737 predicted 1087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008219
AMY1C MISSION shRNA Bacterial Glycerol Stock
amylase, alpha 1C (salivary)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-412s1c1
Sequence:CCGGGCTCTTGAATGTGAGCGATATCTCGAGATATCGCTCACATTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-949s1c1
Sequence:CCGGCCTGGAGACATAAAGGCAATTCTCGAGAATTGCCTTTATGTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-918s1c1
Sequence:CCGGGTTCAGAATTGATGCTTCCAACTCGAGTTGGAAGCATCAATTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-1679s1c1
Sequence:CCGGGCACATACTGTGATGTCATTTCTCGAGAAATGACATCACAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-1333s1c1
Sequence:CCGGCCTTATGGATTTACACGAGTACTCGAGTACTCGTGTAAATCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-864s1c1
Sequence:CCGGGCGTTCTAAGATTGCCGAATACTCGAGTATTCGGCAATCTTAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-1504s1c1
Sequence:CCGGCGCCAAATAAGGAACATGGTTCTCGAGAACCATGTTCCTTATTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-356s1c1
Sequence:CCGGCACAACAAGGACGAACATCTACTCGAGTAGATGTTCGTCCTTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-397s1c1
Sequence:CCGGCGATGGGTTGATATTGCTCTTCTCGAGAAGAGCAATATCAACCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-1005s1c1
Sequence:CCGGCCCGGAAGGTAGTAAACCTTTCTCGAGAAAGGTTTACTACCTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008219
AMY1C MISSION shRNA shRNA Plasmid DNA
amylase, alpha 1C (salivary)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-412s1c1
Sequence:CCGGGCTCTTGAATGTGAGCGATATCTCGAGATATCGCTCACATTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-949s1c1
Sequence:CCGGCCTGGAGACATAAAGGCAATTCTCGAGAATTGCCTTTATGTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-918s1c1
Sequence:CCGGGTTCAGAATTGATGCTTCCAACTCGAGTTGGAAGCATCAATTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-1679s1c1
Sequence:CCGGGCACATACTGTGATGTCATTTCTCGAGAAATGACATCACAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-1333s1c1
Sequence:CCGGCCTTATGGATTTACACGAGTACTCGAGTACTCGTGTAAATCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-864s1c1
Sequence:CCGGGCGTTCTAAGATTGCCGAATACTCGAGTATTCGGCAATCTTAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-1504s1c1
Sequence:CCGGCGCCAAATAAGGAACATGGTTCTCGAGAACCATGTTCCTTATTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-356s1c1
Sequence:CCGGCACAACAAGGACGAACATCTACTCGAGTAGATGTTCGTCCTTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-397s1c1
Sequence:CCGGCGATGGGTTGATATTGCTCTTCTCGAGAAGAGCAATATCAACCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-1005s1c1
Sequence:CCGGCCCGGAAGGTAGTAAACCTTTCTCGAGAAAGGTTTACTACCTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008219
AMY1C MISSION shRNA Lentiviral Transduction Particles
amylase, alpha 1C (salivary)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-412s1c1
Sequence:CCGGGCTCTTGAATGTGAGCGATATCTCGAGATATCGCTCACATTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-949s1c1
Sequence:CCGGCCTGGAGACATAAAGGCAATTCTCGAGAATTGCCTTTATGTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-918s1c1
Sequence:CCGGGTTCAGAATTGATGCTTCCAACTCGAGTTGGAAGCATCAATTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-1679s1c1
Sequence:CCGGGCACATACTGTGATGTCATTTCTCGAGAAATGACATCACAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-1333s1c1
Sequence:CCGGCCTTATGGATTTACACGAGTACTCGAGTACTCGTGTAAATCCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-864s1c1
Sequence:CCGGGCGTTCTAAGATTGCCGAATACTCGAGTATTCGGCAATCTTAGAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-1504s1c1
Sequence:CCGGCGCCAAATAAGGAACATGGTTCTCGAGAACCATGTTCCTTATTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-356s1c1
Sequence:CCGGCACAACAAGGACGAACATCTACTCGAGTAGATGTTCGTCCTTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008219.1-397s1c1
Sequence:CCGGCGATGGGTTGATATTGCTCTTCTCGAGAAGAGCAATATCAACCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008219.1-1005s1c1
Sequence:CCGGCCCGGAAGGTAGTAAACCTTTCTCGAGAAAGGTTTACTACCTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks