EMAIL THIS PAGE TO A FRIEND

AMY2A

amylase, alpha 2A (pancreatic)

18 Gene Product Result for
Synonyms: AMY2 AMY2B PA
UniProtKB ID: P04746, Q9UBH3
Gene ID:
Human(279) Summary: Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jul 2008]
domestic guinea pig(100724525) amylase, alpha 2A (pancreatic)
Domestic Rabbit(100343733) amylase, alpha 2A (pancreatic)
Zebrafish(406539) amylase, alpha 2A; pancreatic
cow(281623) amylase, alpha 2A (pancreatic)
cow(539383) amylase, alpha 2A (pancreatic)
chicken(414140) amylase, alpha 2A; pancreatic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000699 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166128 predicted 559
2 SASI_Hs01_00166129 predicted 289
3 SASI_Hs01_00166130 predicted 303
4 SASI_Hs01_00166131 predicted 739
5 SASI_Hs01_00166132 predicted 859
6 SASI_Hs01_00166133 predicted 1272
7 SASI_Hs01_00166134 predicted 583
8 SASI_Hs01_00166135 predicted 1169
9 SASI_Hs01_00166136 predicted 1261
10 SASI_Hs01_00166137 predicted 1246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000699
AMY2A MISSION shRNA Bacterial Glycerol Stock
amylase, alpha 2A (pancreatic)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-383s1c1
Sequence:CCGGCGTATTTATGTGGATGCTGTACTCGAGTACAGCATCCACATAAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1449s1c1
Sequence:CCGGGCACATACTGTGATGTCATTTCTCGAGAAATGACATCACAGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1274s1c1
Sequence:CCGGCGCCAAATAAGGAACATGGTTCTCGAGAACCATGTTCCTTATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-779s1c1
Sequence:CCGGGCAGGAAGTAAACCTTTCATTCTCGAGAATGAAAGGTTTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1187s1c1
Sequence:CCGGCCACCAAATAATAATGGAGTACTCGAGTACTCCATTATTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000699.2-1487s21c1
Sequence:CCGGGGCAATTGCACAGGCATTAAACTCGAGTTTAATGCCTGTGCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000699
AMY2A MISSION shRNA shRNA Plasmid DNA
amylase, alpha 2A (pancreatic)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-383s1c1
Sequence:CCGGCGTATTTATGTGGATGCTGTACTCGAGTACAGCATCCACATAAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1449s1c1
Sequence:CCGGGCACATACTGTGATGTCATTTCTCGAGAAATGACATCACAGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1274s1c1
Sequence:CCGGCGCCAAATAAGGAACATGGTTCTCGAGAACCATGTTCCTTATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-779s1c1
Sequence:CCGGGCAGGAAGTAAACCTTTCATTCTCGAGAATGAAAGGTTTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1187s1c1
Sequence:CCGGCCACCAAATAATAATGGAGTACTCGAGTACTCCATTATTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000699.2-1487s21c1
Sequence:CCGGGGCAATTGCACAGGCATTAAACTCGAGTTTAATGCCTGTGCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000699
AMY2A MISSION shRNA Lentiviral Transduction Particles
amylase, alpha 2A (pancreatic)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-383s1c1
Sequence:CCGGCGTATTTATGTGGATGCTGTACTCGAGTACAGCATCCACATAAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1449s1c1
Sequence:CCGGGCACATACTGTGATGTCATTTCTCGAGAAATGACATCACAGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1274s1c1
Sequence:CCGGCGCCAAATAAGGAACATGGTTCTCGAGAACCATGTTCCTTATTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-779s1c1
Sequence:CCGGGCAGGAAGTAAACCTTTCATTCTCGAGAATGAAAGGTTTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000699.2-1187s1c1
Sequence:CCGGCCACCAAATAATAATGGAGTACTCGAGTACTCCATTATTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000699.2-1487s21c1
Sequence:CCGGGGCAATTGCACAGGCATTAAACTCGAGTTTAATGCCTGTGCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks