EMAIL THIS PAGE TO A FRIEND

AMY2B

amylase, alpha 2B (pancreatic)

42 Gene Product Result for
Synonyms: AMY2 AMY3 HXA
UniProtKB ID: P19961, B3KXB7, D3DT76, Q9UBH3
Gene ID:
Human(280) Summary: Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jun 2013]
Mouse(545562) amylase 2b
sheep(101118573) amylase, alpha 2B (pancreatic)
domestic cat(101093124) amylase, alpha 2B (pancreatic)
dog(479922) amylase, alpha 2B (pancreatic)
cow(505049) amylase, alpha 2B (pancreatic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020978 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020978 Rosetta Predictions human pricing
XM_001481315 Rosetta Predictions mouse pricing
XM_001481336 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354422 predicted 1128
2 SASI_Hs01_00021634 predicted 1103
3 SASI_Hs01_00021635 predicted 675
4 SASI_Hs01_00021636 predicted 848
5 SASI_Hs01_00021637 predicted 732
6 SASI_Hs01_00021638 predicted 691
7 SASI_Hs01_00021639 predicted 1829
8 SASI_Hs01_00021640 predicted 1291
9 SASI_Hs01_00021641 predicted 1838
10 SASI_Hs01_00021642 predicted 1412
11 SASI_Hs01_00021643 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423654 predicted 979
2 SASI_Mm02_00423655 predicted 844
3 SASI_Mm02_00423656 predicted 821
4 SASI_Mm02_00423657 predicted 1138
5 SASI_Mm02_00423658 predicted 485
6 SASI_Mm02_00423659 predicted 809
7 SASI_Mm02_00423660 predicted 488
8 SASI_Mm02_00423661 predicted 1244
9 SASI_Mm02_00423662 predicted 367
10 SASI_Mm02_00423663 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423808 predicted 985
2 SASI_Mm02_00423809 predicted 842
3 SASI_Mm02_00423810 predicted 817
4 SASI_Mm02_00423811 predicted 1132
5 SASI_Mm02_00423812 predicted 483
6 SASI_Mm02_00423813 predicted 813
7 SASI_Mm02_00423814 predicted 491
8 SASI_Mm02_00423815 predicted 1243
9 SASI_Mm02_00423816 predicted 364
10 SASI_Mm02_00423817 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020978
AMY2B MISSION shRNA Bacterial Glycerol Stock
amylase, alpha 2B (pancreatic)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020978.3-1209s21c1
Sequence:CCGGTGAATCATCTCATTGACATTGCTCGAGCAATGTCAATGAGATGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020978.3-1036s21c1
Sequence:CCGGCTTTCCAGCAGTCCCATATTCCTCGAGGAATATGGGACTGCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-934s1c1
Sequence:CCGGGCGTTCCAAGATTGCCGAATACTCGAGTATTCGGCAATCTTGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-595s1c1
Sequence:CCGGCCAACCAGTTAGCTATAAATTCTCGAGAATTTATAGCTAACTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-467s1c1
Sequence:CCGGCGATGGGTTGATATTGCTCTTCTCGAGAAGAGCAATATCAACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-1019s1c1
Sequence:CCGGCCTGGAGACATAAAGGCAATTCTCGAGAATTGCCTTTATGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020978
AMY2B MISSION shRNA shRNA Plasmid DNA
amylase, alpha 2B (pancreatic)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020978.3-1209s21c1
Sequence:CCGGTGAATCATCTCATTGACATTGCTCGAGCAATGTCAATGAGATGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020978.3-1036s21c1
Sequence:CCGGCTTTCCAGCAGTCCCATATTCCTCGAGGAATATGGGACTGCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-934s1c1
Sequence:CCGGGCGTTCCAAGATTGCCGAATACTCGAGTATTCGGCAATCTTGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-595s1c1
Sequence:CCGGCCAACCAGTTAGCTATAAATTCTCGAGAATTTATAGCTAACTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-467s1c1
Sequence:CCGGCGATGGGTTGATATTGCTCTTCTCGAGAAGAGCAATATCAACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-1019s1c1
Sequence:CCGGCCTGGAGACATAAAGGCAATTCTCGAGAATTGCCTTTATGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020978
AMY2B MISSION shRNA Lentiviral Transduction Particles
amylase, alpha 2B (pancreatic)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020978.3-1209s21c1
Sequence:CCGGTGAATCATCTCATTGACATTGCTCGAGCAATGTCAATGAGATGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020978.3-1036s21c1
Sequence:CCGGCTTTCCAGCAGTCCCATATTCCTCGAGGAATATGGGACTGCTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-934s1c1
Sequence:CCGGGCGTTCCAAGATTGCCGAATACTCGAGTATTCGGCAATCTTGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-595s1c1
Sequence:CCGGCCAACCAGTTAGCTATAAATTCTCGAGAATTTATAGCTAACTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-467s1c1
Sequence:CCGGCGATGGGTTGATATTGCTCTTCTCGAGAAGAGCAATATCAACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020978.2-1019s1c1
Sequence:CCGGCCTGGAGACATAAAGGCAATTCTCGAGAATTGCCTTTATGTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks