EMAIL THIS PAGE TO A FRIEND

AMZ2

archaelysin family metallopeptidase 2

100 Gene Product Result for
UniProtKB ID: Q86W34, A6NLD9, B3KR44, Q5XKF1, Q9NZE2
Gene ID:
Mouse(13929) archaelysin family metallopeptidase 2
Rat(360650) archaelysin family metallopeptidase 2
domestic guinea pig(100730606) archaelysin family metallopeptidase 2
naked mole-rat(101719958) archaelysin family metallopeptidase 2
sheep(101116329) archaelysin family metallopeptidase 2
cow(515126) archaelysin family metallopeptidase 2
Horse(100062918) archaelysin family metallopeptidase 2
domestic cat(101087887) archaelysin family metallopeptidase 2
dog(480461) archaelysin family metallopeptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033569 Rosetta Predictions human pricing
NM_001033570 Rosetta Predictions human pricing
NM_001033571 Rosetta Predictions human pricing
NM_001033572 Rosetta Predictions human pricing
NM_001033574 Rosetta Predictions human pricing
NM_016627 Rosetta Predictions human pricing
NM_001014121 Rosetta Predictions rat pricing
NM_025275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102520 predicted 1130
2 SASI_Hs01_00102521 predicted 1048
3 SASI_Hs01_00102522 predicted 1159
4 SASI_Hs01_00102523 predicted 998
5 SASI_Hs01_00102524 predicted 968
6 SASI_Hs01_00102525 predicted 902
7 SASI_Hs01_00102526 predicted 859
8 SASI_Hs01_00102527 predicted 880
9 SASI_Hs01_00102528 predicted 1036
10 SASI_Hs01_00102529 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169823 predicted 1126
2 SASI_Hs01_00169824 predicted 1045
3 SASI_Hs01_00169825 predicted 1156
4 SASI_Hs01_00169826 predicted 994
5 SASI_Hs01_00169827 predicted 960
6 SASI_Hs01_00169828 predicted 897
7 SASI_Hs01_00169829 predicted 849
8 SASI_Hs01_00169830 predicted 870
9 SASI_Hs01_00169831 predicted 1040
10 SASI_Hs01_00169832 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087330 predicted 1105
2 SASI_Hs01_00087331 predicted 1017
3 SASI_Hs01_00087332 predicted 1132
4 SASI_Hs01_00087333 predicted 972
5 SASI_Hs01_00087334 predicted 935
6 SASI_Hs01_00087335 predicted 873
7 SASI_Hs01_00087336 predicted 832
8 SASI_Hs01_00087337 predicted 845
9 SASI_Hs01_00087338 predicted 1009
10 SASI_Hs01_00087339 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120042 predicted 1099
2 SASI_Hs01_00120043 predicted 1014
3 SASI_Hs01_00120044 predicted 1127
4 SASI_Hs01_00120045 predicted 967
5 SASI_Hs01_00120046 predicted 930
6 SASI_Hs01_00120047 predicted 873
7 SASI_Hs01_00120048 predicted 828
8 SASI_Hs01_00120049 predicted 846
9 SASI_Hs01_00120050 predicted 1012
10 SASI_Hs01_00120051 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070552 predicted 1508
2 SASI_Hs01_00070553 predicted 1422
3 SASI_Hs01_00070554 predicted 1539
4 SASI_Hs01_00070555 predicted 1373
5 SASI_Hs01_00070556 predicted 1341
6 SASI_Hs01_00070557 predicted 1282
7 SASI_Hs01_00070558 predicted 1235
8 SASI_Hs01_00070559 predicted 1260
9 SASI_Hs01_00070560 predicted 1422
10 SASI_Hs01_00070561 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225085 predicted 1684
2 SASI_Hs01_00225086 predicted 1595
3 SASI_Hs01_00225087 predicted 1711
4 SASI_Hs01_00225088 predicted 1553
5 SASI_Hs01_00225089 predicted 1514
6 SASI_Hs01_00225090 predicted 1458
7 SASI_Hs01_00225091 predicted 1411
8 SASI_Hs01_00225092 predicted 1432
9 SASI_Hs01_00225093 predicted 1589
10 SASI_Hs01_00225094 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057544 predicted 655
2 SASI_Rn01_00057546 predicted 927
3 SASI_Rn02_00201565 predicted 977
4 SASI_Rn01_00057547 predicted 1271
5 SASI_Rn02_00201566 predicted 783
6 SASI_Rn01_00057548 predicted 1245
7 SASI_Rn01_00057549 predicted 619
8 SASI_Rn01_00057550 predicted 634
9 SASI_Rn01_00057551 predicted 719
10 SASI_Rn01_00057552 predicted 772
11 SASI_Rn01_00057545 predicted 826
12 SASI_Rn01_00057553 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104652 predicted 450
2 SASI_Mm01_00104653 predicted 757
3 SASI_Mm01_00104654 predicted 708
4 SASI_Mm01_00104655 predicted 1007
5 SASI_Mm01_00104657 predicted 740
6 SASI_Mm01_00104658 predicted 559
7 SASI_Mm02_00327880 predicted 586
8 SASI_Mm01_00104660 predicted 1349
9 SASI_Mm02_00327881 predicted 1472
10 SASI_Mm01_00104661 predicted 917
11 SASI_Mm01_00104656 predicted 722
12 SASI_Mm01_00104659 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016627
VALIDATED
AMZ2 MISSION shRNA Bacterial Glycerol Stock
archaelysin family metallopeptidase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-837s21c1
Sequence:CCGGTGATCTCTTTGGACCCATTACCTCGAGGTAATGGGTCCAAAGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-760s21c1
Sequence:CCGGCCAGTGCTTGTATCACAGTATCTCGAGATACTGTGATACAAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-952s21c1
Sequence:CCGGCCAAACAAACGCAGCATTTATCTCGAGATAAATGCTGCGTTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-1789s21c1
Sequence:CCGGCCTTCAAATAGGAGTGATTGACTCGAGTCAATCACTCCTATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1190s1c1
Sequence:CCGGCCAGTGCTTGTATCACAGTATCTCGAGATACTGTGATACAAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016627.3-2123s1c1
Sequence:CCGGCACGAGGATAATGGGAATTTACTCGAGTAAATTCCCATTATCCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1382s1c1
Sequence:CCGGCCAAACAAACGCAGCATTTATCTCGAGATAAATGCTGCGTTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016627.3-2219s1c1
Sequence:CCGGCCTTCAAATAGGAGTGATTGACTCGAGTCAATCACTCCTATTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1891s1c1
Sequence:CCGGCCATGAGATCGGACACATATTCTCGAGAATATGTGTCCGATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016627.3-2217s1c1
Sequence:CCGGGACCTTCAAATAGGAGTGATTCTCGAGAATCACTCCTATTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016627
VALIDATED
AMZ2 MISSION shRNA shRNA Plasmid DNA
archaelysin family metallopeptidase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-837s21c1
Sequence:CCGGTGATCTCTTTGGACCCATTACCTCGAGGTAATGGGTCCAAAGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-760s21c1
Sequence:CCGGCCAGTGCTTGTATCACAGTATCTCGAGATACTGTGATACAAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-952s21c1
Sequence:CCGGCCAAACAAACGCAGCATTTATCTCGAGATAAATGCTGCGTTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-1789s21c1
Sequence:CCGGCCTTCAAATAGGAGTGATTGACTCGAGTCAATCACTCCTATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1190s1c1
Sequence:CCGGCCAGTGCTTGTATCACAGTATCTCGAGATACTGTGATACAAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016627.3-2123s1c1
Sequence:CCGGCACGAGGATAATGGGAATTTACTCGAGTAAATTCCCATTATCCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1382s1c1
Sequence:CCGGCCAAACAAACGCAGCATTTATCTCGAGATAAATGCTGCGTTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016627.3-2219s1c1
Sequence:CCGGCCTTCAAATAGGAGTGATTGACTCGAGTCAATCACTCCTATTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1891s1c1
Sequence:CCGGCCATGAGATCGGACACATATTCTCGAGAATATGTGTCCGATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016627.3-2217s1c1
Sequence:CCGGGACCTTCAAATAGGAGTGATTCTCGAGAATCACTCCTATTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016627
VALIDATED
AMZ2 MISSION shRNA Lentiviral Transduction Particles
archaelysin family metallopeptidase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-837s21c1
Sequence:CCGGTGATCTCTTTGGACCCATTACCTCGAGGTAATGGGTCCAAAGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-760s21c1
Sequence:CCGGCCAGTGCTTGTATCACAGTATCTCGAGATACTGTGATACAAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-952s21c1
Sequence:CCGGCCAAACAAACGCAGCATTTATCTCGAGATAAATGCTGCGTTTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016627.4-1789s21c1
Sequence:CCGGCCTTCAAATAGGAGTGATTGACTCGAGTCAATCACTCCTATTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1190s1c1
Sequence:CCGGCCAGTGCTTGTATCACAGTATCTCGAGATACTGTGATACAAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016627.3-2123s1c1
Sequence:CCGGCACGAGGATAATGGGAATTTACTCGAGTAAATTCCCATTATCCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1382s1c1
Sequence:CCGGCCAAACAAACGCAGCATTTATCTCGAGATAAATGCTGCGTTTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016627.3-2219s1c1
Sequence:CCGGCCTTCAAATAGGAGTGATTGACTCGAGTCAATCACTCCTATTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016627.3-1891s1c1
Sequence:CCGGCCATGAGATCGGACACATATTCTCGAGAATATGTGTCCGATCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016627.3-2217s1c1
Sequence:CCGGGACCTTCAAATAGGAGTGATTCTCGAGAATCACTCCTATTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025275
VALIDATED
AMZ2 MISSION shRNA Bacterial Glycerol Stock
archaelysin family metallopeptidase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-1098s21c1
Sequence:CCGGCCAGTGGCTTGCGTGTTTAATCTCGAGATTAAACACGCAAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-848s21c1
Sequence:CCGGACTCGTGGAACTTCGTCTTTGCTCGAGCAAAGACGAAGTTCCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-883s21c1
Sequence:CCGGTCAAGTGGTGTGGGCATATTCCTCGAGGAATATGCCCACACCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025275.4-695s21c1
Sequence:CCGGCGGTCTCTGAAACCAAGTGTTCTCGAGAACACTTGGTTTCAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025275.4-1597s21c1
Sequence:CCGGCTGCCCTTCAGATAGGATTAGCTCGAGCTAATCCTATCTGAAGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025275.2-1387s1c1
Sequence:CCGGCCCTTTAAATAGCACAACATTCTCGAGAATGTTGTGCTATTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-973s1c1
Sequence:CCGGGATAACTATTACATCCCTGAACTCGAGTTCAGGGATGTAATAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-668s1c1
Sequence:CCGGCGGTCTCTGAAACCAAGTGTTCTCGAGAACACTTGGTTTCAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025275.2-906s1c1
Sequence:CCGGCACCTCGAAATACGAAGGCAACTCGAGTTGCCTTCGTATTTCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-1071s1c1
Sequence:CCGGCCAGTGGCTTGCGTGTTTAATCTCGAGATTAAACACGCAAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025275
VALIDATED
AMZ2 MISSION shRNA shRNA Plasmid DNA
archaelysin family metallopeptidase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-1098s21c1
Sequence:CCGGCCAGTGGCTTGCGTGTTTAATCTCGAGATTAAACACGCAAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-848s21c1
Sequence:CCGGACTCGTGGAACTTCGTCTTTGCTCGAGCAAAGACGAAGTTCCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-883s21c1
Sequence:CCGGTCAAGTGGTGTGGGCATATTCCTCGAGGAATATGCCCACACCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025275.4-695s21c1
Sequence:CCGGCGGTCTCTGAAACCAAGTGTTCTCGAGAACACTTGGTTTCAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025275.4-1597s21c1
Sequence:CCGGCTGCCCTTCAGATAGGATTAGCTCGAGCTAATCCTATCTGAAGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025275.2-1387s1c1
Sequence:CCGGCCCTTTAAATAGCACAACATTCTCGAGAATGTTGTGCTATTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-973s1c1
Sequence:CCGGGATAACTATTACATCCCTGAACTCGAGTTCAGGGATGTAATAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-668s1c1
Sequence:CCGGCGGTCTCTGAAACCAAGTGTTCTCGAGAACACTTGGTTTCAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025275.2-906s1c1
Sequence:CCGGCACCTCGAAATACGAAGGCAACTCGAGTTGCCTTCGTATTTCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-1071s1c1
Sequence:CCGGCCAGTGGCTTGCGTGTTTAATCTCGAGATTAAACACGCAAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025275
VALIDATED
AMZ2 MISSION shRNA Lentiviral Transduction Particles
archaelysin family metallopeptidase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-1098s21c1
Sequence:CCGGCCAGTGGCTTGCGTGTTTAATCTCGAGATTAAACACGCAAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-848s21c1
Sequence:CCGGACTCGTGGAACTTCGTCTTTGCTCGAGCAAAGACGAAGTTCCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025275.4-883s21c1
Sequence:CCGGTCAAGTGGTGTGGGCATATTCCTCGAGGAATATGCCCACACCACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025275.4-695s21c1
Sequence:CCGGCGGTCTCTGAAACCAAGTGTTCTCGAGAACACTTGGTTTCAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025275.4-1597s21c1
Sequence:CCGGCTGCCCTTCAGATAGGATTAGCTCGAGCTAATCCTATCTGAAGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025275.2-1387s1c1
Sequence:CCGGCCCTTTAAATAGCACAACATTCTCGAGAATGTTGTGCTATTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-973s1c1
Sequence:CCGGGATAACTATTACATCCCTGAACTCGAGTTCAGGGATGTAATAGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-668s1c1
Sequence:CCGGCGGTCTCTGAAACCAAGTGTTCTCGAGAACACTTGGTTTCAGAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025275.2-906s1c1
Sequence:CCGGCACCTCGAAATACGAAGGCAACTCGAGTTGCCTTCGTATTTCGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025275.2-1071s1c1
Sequence:CCGGCCAGTGGCTTGCGTGTTTAATCTCGAGATTAAACACGCAAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks