EMAIL THIS PAGE TO A FRIEND

ANAPC10

anaphase promoting complex subunit 10

Synonyms: APC10 DOC1
UniProtKB ID: Q9UM13, D3DNZ7, Q2V500, Q9UG51, Q9Y5R0
Gene ID:
Human(10393) Summary: ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]
Mouse(68999) anaphase promoting complex subunit 10
Rat(361389) anaphase promoting complex subunit 10
domestic guinea pig(100728363) anaphase promoting complex subunit 10
naked mole-rat(101724776) anaphase promoting complex subunit 10
sheep(101111128) anaphase promoting complex subunit 10
Zebrafish(798352) anaphase promoting complex subunit 10
chicken(422461) anaphase promoting complex subunit 10
cow(783986) anaphase promoting complex subunit 10
domestic cat(101086802) anaphase promoting complex subunit 10
dog(475453) anaphase promoting complex subunit 10
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014885 Rosetta Predictions human pricing
NM_001108445 Rosetta Predictions rat pricing
NM_026904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346501 predicted 486
2 SASI_Hs01_00109268 predicted 460
3 SASI_Hs02_00346502 predicted 512
4 SASI_Hs02_00346503 predicted 312
5 SASI_Hs02_00346504 predicted 470
6 SASI_Hs02_00346505 predicted 313
7 SASI_Hs02_00346506 predicted 453
8 SASI_Hs02_00346507 predicted 529
9 SASI_Hs02_00346508 predicted 518
10 SASI_Hs01_00109265 predicted 224
11 SASI_Hs01_00109266 predicted 678
12 SASI_Hs01_00109267 predicted 249
13 SASI_Hs01_00109269 predicted 276
14 SASI_Hs01_00109270 predicted 571
15 SASI_Hs01_00109271 predicted 390
16 SASI_Hs01_00109272 predicted 579
17 SASI_Hs01_00109273 predicted 643
18 SASI_Hs01_00109274 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238709 predicted 799
2 SASI_Rn02_00238710 predicted 757
3 SASI_Rn02_00238711 predicted 533
4 SASI_Rn02_00238712 predicted 747
5 SASI_Rn02_00238713 predicted 309
6 SASI_Rn02_00238714 predicted 692
7 SASI_Rn02_00238715 predicted 278
8 SASI_Rn02_00238716 predicted 396
9 SASI_Rn02_00238717 predicted 778
10 SASI_Rn02_00238718 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021369 predicted 499
2 SASI_Mm01_00021370 predicted 319
3 SASI_Mm01_00021371 predicted 535
4 SASI_Mm01_00021373 predicted 521
5 SASI_Mm01_00021375 predicted 444
6 SASI_Mm01_00021376 predicted 194
7 SASI_Mm01_00021377 predicted 655
8 SASI_Mm01_00021378 predicted 262
9 SASI_Mm02_00331177 predicted 606
10 SASI_Mm02_00331178 predicted 310
11 SASI_Mm01_00021372 predicted 434
12 SASI_Mm01_00021374 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014885
VALIDATED
ANAPC10 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-312s21c1
Sequence:CCGGACAACAGTGAAGACATTATGTCTCGAGACATAATGTCTTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-496s21c1
Sequence:CCGGGTACATTCATGATACAGATTGCTCGAGCAATCTGTATCATGAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-520s21c1
Sequence:CCGGTTCTAGCCAATCACCAGAATGCTCGAGCATTCTGGTGATTGGCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-379s21c1
Sequence:CCGGTCTCAGTCAGAGTAGGAAATACTCGAGTATTTCCTACTCTGACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-465s21c1
Sequence:CCGGCCCTTAACTGACAATCATAAGCTCGAGCTTATGATTGTCAGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-222s1c1
Sequence:CCGGAGTACGGGAAATTGGGTCACACTCGAGTGTGACCCAATTTCCCGTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-443s1c1
Sequence:CCGGCAGTCAGAGTAGGAAATAATTCTCGAGAATTATTTCCTACTCTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014885.x-797s1c1
Sequence:CCGGACAAGGCATCCGTTATATCTACTCGAGTAGATATAACGGATGCCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-535s1c1
Sequence:CCGGGACAATCATAAGAAGCCAACTCTCGAGAGTTGGCTTCTTATGATTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-279s1c1
Sequence:CCGGTGGAGTGGATCAGTTACGAGACTCGAGTCTCGTAACTGATCCACTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014885
VALIDATED
ANAPC10 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-312s21c1
Sequence:CCGGACAACAGTGAAGACATTATGTCTCGAGACATAATGTCTTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-496s21c1
Sequence:CCGGGTACATTCATGATACAGATTGCTCGAGCAATCTGTATCATGAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-520s21c1
Sequence:CCGGTTCTAGCCAATCACCAGAATGCTCGAGCATTCTGGTGATTGGCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-379s21c1
Sequence:CCGGTCTCAGTCAGAGTAGGAAATACTCGAGTATTTCCTACTCTGACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-465s21c1
Sequence:CCGGCCCTTAACTGACAATCATAAGCTCGAGCTTATGATTGTCAGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-222s1c1
Sequence:CCGGAGTACGGGAAATTGGGTCACACTCGAGTGTGACCCAATTTCCCGTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-443s1c1
Sequence:CCGGCAGTCAGAGTAGGAAATAATTCTCGAGAATTATTTCCTACTCTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014885.x-797s1c1
Sequence:CCGGACAAGGCATCCGTTATATCTACTCGAGTAGATATAACGGATGCCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-535s1c1
Sequence:CCGGGACAATCATAAGAAGCCAACTCTCGAGAGTTGGCTTCTTATGATTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-279s1c1
Sequence:CCGGTGGAGTGGATCAGTTACGAGACTCGAGTCTCGTAACTGATCCACTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014885
VALIDATED
ANAPC10 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-312s21c1
Sequence:CCGGACAACAGTGAAGACATTATGTCTCGAGACATAATGTCTTCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-496s21c1
Sequence:CCGGGTACATTCATGATACAGATTGCTCGAGCAATCTGTATCATGAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-520s21c1
Sequence:CCGGTTCTAGCCAATCACCAGAATGCTCGAGCATTCTGGTGATTGGCTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-379s21c1
Sequence:CCGGTCTCAGTCAGAGTAGGAAATACTCGAGTATTTCCTACTCTGACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014885.3-465s21c1
Sequence:CCGGCCCTTAACTGACAATCATAAGCTCGAGCTTATGATTGTCAGTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-222s1c1
Sequence:CCGGAGTACGGGAAATTGGGTCACACTCGAGTGTGACCCAATTTCCCGTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-443s1c1
Sequence:CCGGCAGTCAGAGTAGGAAATAATTCTCGAGAATTATTTCCTACTCTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014885.x-797s1c1
Sequence:CCGGACAAGGCATCCGTTATATCTACTCGAGTAGATATAACGGATGCCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-535s1c1
Sequence:CCGGGACAATCATAAGAAGCCAACTCTCGAGAGTTGGCTTCTTATGATTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014885.x-279s1c1
Sequence:CCGGTGGAGTGGATCAGTTACGAGACTCGAGTCTCGTAACTGATCCACTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026904
VALIDATED
ANAPC10 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026904.1-1794s1c1
Sequence:CCGGCCCGAAACAATGATAATTCAACTCGAGTTGAATTATCATTGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026904.1-326s1c1
Sequence:CCGGGCAGACTATAAGTCTGATGAACTCGAGTTCATCAGACTTATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-410s1c1
Sequence:CCGGCGGCAACTTGAATTGGTGGAACTCGAGTTCCACCAATTCAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-538s1c1
Sequence:CCGGCCACATGAGACAAATTAAGATCTCGAGATCTTAATTTGTCTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-582s1c1
Sequence:CCGGCCATTGGGAAATTCCCTAGATCTCGAGATCTAGGGAATTTCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026904
VALIDATED
ANAPC10 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026904.1-1794s1c1
Sequence:CCGGCCCGAAACAATGATAATTCAACTCGAGTTGAATTATCATTGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026904.1-326s1c1
Sequence:CCGGGCAGACTATAAGTCTGATGAACTCGAGTTCATCAGACTTATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-410s1c1
Sequence:CCGGCGGCAACTTGAATTGGTGGAACTCGAGTTCCACCAATTCAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-538s1c1
Sequence:CCGGCCACATGAGACAAATTAAGATCTCGAGATCTTAATTTGTCTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-582s1c1
Sequence:CCGGCCATTGGGAAATTCCCTAGATCTCGAGATCTAGGGAATTTCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026904
VALIDATED
ANAPC10 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026904.1-1794s1c1
Sequence:CCGGCCCGAAACAATGATAATTCAACTCGAGTTGAATTATCATTGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026904.1-326s1c1
Sequence:CCGGGCAGACTATAAGTCTGATGAACTCGAGTTCATCAGACTTATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-410s1c1
Sequence:CCGGCGGCAACTTGAATTGGTGGAACTCGAGTTCCACCAATTCAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-538s1c1
Sequence:CCGGCCACATGAGACAAATTAAGATCTCGAGATCTTAATTTGTCTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026904.1-582s1c1
Sequence:CCGGCCATTGGGAAATTCCCTAGATCTCGAGATCTAGGGAATTTCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks