EMAIL THIS PAGE TO A FRIEND

ANAPC11

anaphase promoting complex subunit 11

147 Gene Product Result for
Synonyms: APC11 Apc11p
UniProtKB ID: Q9NYG5, A8MTT2, B7ZW64, Q502X9, Q9BW64, Q9P0R2
Gene ID:
Mouse(66156) anaphase promoting complex subunit 11
Rat(498030) anaphase promoting complex subunit 11
Zebrafish(768140) APC11 anaphase promoting complex subunit 11 homolog (yeast)
dog(483370) anaphase promoting complex subunit 11
cow(616275) anaphase promoting complex subunit 11
domestic cat(101090158) anaphase promoting complex subunit 11
sheep(101114121) anaphase promoting complex subunit 11
naked mole-rat(101713652) anaphase promoting complex subunit 11
domestic guinea pig(100734505) anaphase promoting complex subunit 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002244 Rosetta Predictions human pricing
NM_001002245 Rosetta Predictions human pricing
NM_001002246 Rosetta Predictions human pricing
NM_001002247 Rosetta Predictions human pricing
NM_001002248 Rosetta Predictions human pricing
NM_001002249 Rosetta Predictions human pricing
NM_016476 Rosetta Predictions human pricing
NM_001126082 Rosetta Predictions rat pricing
NM_001038230 Rosetta Predictions mouse pricing
NM_025389 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220276 predicted 833
2 SASI_Hs01_00220277 predicted 866
3 SASI_Hs01_00220278 predicted 810
4 SASI_Hs01_00220279 predicted 788
5 SASI_Hs01_00220280 predicted 814
6 SASI_Hs01_00220281 predicted 888
7 SASI_Hs01_00220282 predicted 874
8 SASI_Hs01_00220283 predicted 883
9 SASI_Hs01_00220284 predicted 814
10 SASI_Hs02_00304134 predicted 807
11 SASI_Hs01_00220285 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244634 predicted 505
2 SASI_Hs01_00244635 predicted 542
3 SASI_Hs01_00244636 predicted 480
4 SASI_Hs01_00244637 predicted 463
5 SASI_Hs01_00244638 predicted 482
6 SASI_Hs01_00244639 predicted 549
7 SASI_Hs01_00244640 predicted 539
8 SASI_Hs01_00244641 predicted 549
9 SASI_Hs01_00244642 predicted 474
10 SASI_Hs02_00304135 predicted 480
11 SASI_Hs01_00244643 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024597 predicted 564
2 SASI_Hs01_00024598 predicted 607
3 SASI_Hs01_00024599 predicted 540
4 SASI_Hs01_00024600 predicted 519
5 SASI_Hs01_00024601 predicted 546
6 SASI_Hs01_00024602 predicted 614
7 SASI_Hs01_00024603 predicted 602
8 SASI_Hs01_00024604 predicted 611
9 SASI_Hs01_00024605 predicted 537
10 SASI_Hs02_00304136 predicted 536
11 SASI_Hs01_00024606 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052038 predicted 509
2 SASI_Hs01_00052039 predicted 550
3 SASI_Hs01_00052040 predicted 491
4 SASI_Hs01_00052041 predicted 473
5 SASI_Hs01_00052042 predicted 490
6 SASI_Hs01_00052043 predicted 561
7 SASI_Hs01_00052044 predicted 548
8 SASI_Hs01_00052045 predicted 561
9 SASI_Hs01_00052046 predicted 487
10 SASI_Hs02_00304137 predicted 486
11 SASI_Hs01_00052047 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105647 predicted 573
2 SASI_Hs01_00105648 predicted 607
3 SASI_Hs01_00105649 predicted 556
4 SASI_Hs01_00105650 predicted 532
5 SASI_Hs01_00105651 predicted 546
6 SASI_Hs01_00105652 predicted 623
7 SASI_Hs01_00105653 predicted 615
8 SASI_Hs01_00105654 predicted 622
9 SASI_Hs01_00105655 predicted 549
10 SASI_Hs02_00304138 predicted 545
11 SASI_Hs01_00105656 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144829 predicted 620
2 SASI_Hs01_00144830 predicted 655
3 SASI_Hs01_00144831 predicted 602
4 SASI_Hs01_00144832 predicted 581
5 SASI_Hs01_00144833 predicted 595
6 SASI_Hs01_00144834 predicted 674
7 SASI_Hs01_00144835 predicted 656
8 SASI_Hs01_00144836 predicted 665
9 SASI_Hs01_00144837 predicted 591
10 SASI_Hs02_00304139 predicted 593
11 SASI_Hs01_00144838 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172193 predicted 595
2 SASI_Hs01_00172194 predicted 628
3 SASI_Hs01_00172195 predicted 577
4 SASI_Hs01_00172196 predicted 549
5 SASI_Hs01_00172197 predicted 575
6 SASI_Hs01_00172198 predicted 647
7 SASI_Hs01_00172199 predicted 629
8 SASI_Hs01_00172200 predicted 641
9 SASI_Hs01_00172201 predicted 572
10 SASI_Hs02_00349528 predicted 574
11 SASI_Hs01_00172202 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252833 predicted 509
2 SASI_Rn02_00252834 predicted 356
3 SASI_Rn02_00252835 predicted 522
4 SASI_Rn02_00252836 predicted 860
5 SASI_Rn02_00252837 predicted 538
6 SASI_Rn02_00252838 predicted 861
7 SASI_Rn02_00252839 predicted 743
8 SASI_Rn02_00252840 predicted 970
9 SASI_Rn02_00252841 predicted 919
10 SASI_Rn02_00252842 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289589 predicted 719
2 SASI_Mm01_00072947 predicted 999
3 SASI_Mm01_00072948 predicted 333
4 SASI_Mm01_00072949 predicted 491
5 SASI_Mm01_00072950 predicted 727
6 SASI_Mm01_00072951 predicted 420
7 SASI_Mm01_00072952 predicted 929
8 SASI_Mm01_00072953 predicted 615
9 SASI_Mm01_00072954 predicted 947
10 SASI_Mm01_00072955 predicted 362
11 SASI_Mm01_00072946 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328122 predicted 637
2 SASI_Mm01_00199537 predicted 635
3 SASI_Mm01_00199538 predicted 921
4 SASI_Mm01_00199539 predicted 250
5 SASI_Mm01_00199540 predicted 417
6 SASI_Mm01_00199541 predicted 646
7 SASI_Mm01_00199542 predicted 346
8 SASI_Mm01_00199543 predicted 856
9 SASI_Mm01_00199545 predicted 866
10 SASI_Mm01_00199546 predicted 288
11 SASI_Mm01_00199544 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025389
VALIDATED
ANAPC11 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-601s1c1
Sequence:CCGGCCCATCACATTGACACTTTATCTCGAGATAAAGTGTCAATGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-374s1c1
Sequence:CCGGCGCCAGGAGTGGAAGTTCAAACTCGAGTTTGAACTTCCACTCCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-190s1c1
Sequence:CCGGCTGGGTAGCCAATGATGAGAACTCGAGTTCTCATCATTGGCTACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-199s1c1
Sequence:CCGGCAATGATGAGAACTGCGGCATCTCGAGATGCCGCAGTTCTCATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-294s21c1
Sequence:CCGGCTGTAAGGTGCCTGGTGATGACTCGAGTCATCACCAGGCACCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-362s21c1
Sequence:CCGGGCATCCTCAAGTGGCTGAATGCTCGAGCATTCAGCCACTTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-231s21c1
Sequence:CCGGCTGGGTAGCCAATGATGAGAACTCGAGTTCTCATCATTGGCTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025389.3-642s21c1
Sequence:CCGGCCCATCACATTGACACTTTATCTCGAGATAAAGTGTCAATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-259s21c1
Sequence:CCGGATCTGCAGGATGGCGTTTAATCTCGAGATTAAACGCCATCCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025389
VALIDATED
ANAPC11 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-601s1c1
Sequence:CCGGCCCATCACATTGACACTTTATCTCGAGATAAAGTGTCAATGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-374s1c1
Sequence:CCGGCGCCAGGAGTGGAAGTTCAAACTCGAGTTTGAACTTCCACTCCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-190s1c1
Sequence:CCGGCTGGGTAGCCAATGATGAGAACTCGAGTTCTCATCATTGGCTACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-199s1c1
Sequence:CCGGCAATGATGAGAACTGCGGCATCTCGAGATGCCGCAGTTCTCATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-294s21c1
Sequence:CCGGCTGTAAGGTGCCTGGTGATGACTCGAGTCATCACCAGGCACCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-362s21c1
Sequence:CCGGGCATCCTCAAGTGGCTGAATGCTCGAGCATTCAGCCACTTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-231s21c1
Sequence:CCGGCTGGGTAGCCAATGATGAGAACTCGAGTTCTCATCATTGGCTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025389.3-642s21c1
Sequence:CCGGCCCATCACATTGACACTTTATCTCGAGATAAAGTGTCAATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-259s21c1
Sequence:CCGGATCTGCAGGATGGCGTTTAATCTCGAGATTAAACGCCATCCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025389
VALIDATED
ANAPC11 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-601s1c1
Sequence:CCGGCCCATCACATTGACACTTTATCTCGAGATAAAGTGTCAATGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-374s1c1
Sequence:CCGGCGCCAGGAGTGGAAGTTCAAACTCGAGTTTGAACTTCCACTCCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-190s1c1
Sequence:CCGGCTGGGTAGCCAATGATGAGAACTCGAGTTCTCATCATTGGCTACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025389.2-199s1c1
Sequence:CCGGCAATGATGAGAACTGCGGCATCTCGAGATGCCGCAGTTCTCATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-294s21c1
Sequence:CCGGCTGTAAGGTGCCTGGTGATGACTCGAGTCATCACCAGGCACCTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-362s21c1
Sequence:CCGGGCATCCTCAAGTGGCTGAATGCTCGAGCATTCAGCCACTTGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-231s21c1
Sequence:CCGGCTGGGTAGCCAATGATGAGAACTCGAGTTCTCATCATTGGCTACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025389.3-642s21c1
Sequence:CCGGCCCATCACATTGACACTTTATCTCGAGATAAAGTGTCAATGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025389.3-259s21c1
Sequence:CCGGATCTGCAGGATGGCGTTTAATCTCGAGATTAAACGCCATCCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016476
VALIDATED
ANAPC11 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038799    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-489s1c1
Sequence:CCGGGCTGCAACAAGGTGGAAACAACTCGAGTTGTTTCCACCTTGTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-313s1c1
Sequence:CCGGCCACATGCATTGCATCCTCAACTCGAGTTGAGGATGCAATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_016476.9-225s1c1
Sequence:CCGGGCAGGATGGCATTTAACGGATCTCGAGATCCGTTAAATGCCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-202s1c1
Sequence:CCGGCAACGATGAGAACTGTGGCATCTCGAGATGCCACAGTTCTCATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-376s1c1
Sequence:CCGGCCGCCAGGAATGGAAGTTCAACTCGAGTTGAACTTCCATTCCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016476.10-637s21c1
Sequence:CCGGACTCATTAAACTACTCAAATCCTCGAGGATTTGAGTAGTTTAATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016476.10-452s21c1
Sequence:CCGGATGGAAGTTCAAGGAGTGAGGCTCGAGCCTCACTCCTTGAACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016476.10-389s21c1
Sequence:CCGGTTGCATCCTCAAGTGGCTGCACTCGAGTGCAGCCACTTGAGGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016476
VALIDATED
ANAPC11 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038799    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-489s1c1
Sequence:CCGGGCTGCAACAAGGTGGAAACAACTCGAGTTGTTTCCACCTTGTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-313s1c1
Sequence:CCGGCCACATGCATTGCATCCTCAACTCGAGTTGAGGATGCAATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_016476.9-225s1c1
Sequence:CCGGGCAGGATGGCATTTAACGGATCTCGAGATCCGTTAAATGCCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-202s1c1
Sequence:CCGGCAACGATGAGAACTGTGGCATCTCGAGATGCCACAGTTCTCATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-376s1c1
Sequence:CCGGCCGCCAGGAATGGAAGTTCAACTCGAGTTGAACTTCCATTCCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016476.10-637s21c1
Sequence:CCGGACTCATTAAACTACTCAAATCCTCGAGGATTTGAGTAGTTTAATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016476.10-452s21c1
Sequence:CCGGATGGAAGTTCAAGGAGTGAGGCTCGAGCCTCACTCCTTGAACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016476.10-389s21c1
Sequence:CCGGTTGCATCCTCAAGTGGCTGCACTCGAGTGCAGCCACTTGAGGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016476
VALIDATED
ANAPC11 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038799    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-489s1c1
Sequence:CCGGGCTGCAACAAGGTGGAAACAACTCGAGTTGTTTCCACCTTGTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-313s1c1
Sequence:CCGGCCACATGCATTGCATCCTCAACTCGAGTTGAGGATGCAATGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_016476.9-225s1c1
Sequence:CCGGGCAGGATGGCATTTAACGGATCTCGAGATCCGTTAAATGCCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-202s1c1
Sequence:CCGGCAACGATGAGAACTGTGGCATCTCGAGATGCCACAGTTCTCATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016476.9-376s1c1
Sequence:CCGGCCGCCAGGAATGGAAGTTCAACTCGAGTTGAACTTCCATTCCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016476.10-637s21c1
Sequence:CCGGACTCATTAAACTACTCAAATCCTCGAGGATTTGAGTAGTTTAATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016476.10-452s21c1
Sequence:CCGGATGGAAGTTCAAGGAGTGAGGCTCGAGCCTCACTCCTTGAACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016476.10-389s21c1
Sequence:CCGGTTGCATCCTCAAGTGGCTGCACTCGAGTGCAGCCACTTGAGGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks