EMAIL THIS PAGE TO A FRIEND

ANAPC13

anaphase promoting complex subunit 13

Synonyms: APC13 SWM1
UniProtKB ID: Q9BS18, Q9Y3V0
Gene ID:
Human(25847) Summary: This gene encodes a component of the anaphase promoting complex, a large ubiquitin-protein ligase that controls cell cycle progression by regulating the degradation of cell cycle regulators such as B-type cyclins. The encoded protein is evolutionarily conserved and is required for the integrity and ubiquitin ligase activity of the anaphase promoting complex. Pseudogenes and splice variants have been found for this gene; however, the biological validity of some of the splice variants has not been determined. [provided by RefSeq, Nov 2008]
Mouse(69010) anaphase promoting complex subunit 13
Rat(685029) anaphase promoting complex subunit 13
domestic guinea pig(100728170) anaphase promoting complex subunit 13
naked mole-rat(101724802) anaphase promoting complex subunit 13
sheep(101115335) anaphase promoting complex subunit 13
Zebrafish(569473) anaphase promoting complex subunit 13
chicken(769605) anaphase promoting complex subunit 13
dog(609033) anaphase promoting complex subunit 13
cow(614347) anaphase promoting complex subunit 13
domestic cat(101084390) anaphase promoting complex subunit 13
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015391 Rosetta Predictions human pricing
XM_001060533 Rosetta Predictions rat pricing
XM_001060592 Rosetta Predictions rat pricing
NM_181394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067068 predicted 401
2 SASI_Hs01_00067069 predicted 226
3 SASI_Hs01_00067070 predicted 220
4 SASI_Hs01_00067072 predicted 373
5 SASI_Hs01_00067073 predicted 237
6 SASI_Hs01_00067074 predicted 410
7 SASI_Hs01_00067075 predicted 441
8 SASI_Hs01_00067076 predicted 508
9 SASI_Hs01_00067077 predicted 323
10 SASI_Hs02_00347746 predicted 504
11 SASI_Hs01_00067071 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296892 predicted 236
2 SASI_Rn02_00296893 predicted 235
3 SASI_Rn02_00296894 predicted 238
4 SASI_Rn02_00296895 predicted 238
5 SASI_Rn02_00296896 predicted 239
6 SASI_Rn02_00296897 predicted 223
7 SASI_Rn02_00296898 predicted 475
8 SASI_Rn02_00296899 predicted 452
9 SASI_Rn02_00296900 predicted 330
10 SASI_Rn02_00296901 predicted 174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297122 predicted 323
2 SASI_Rn02_00297123 predicted 286
3 SASI_Rn02_00297124 predicted 281
4 SASI_Rn02_00297125 predicted 324
5 SASI_Rn02_00297126 predicted 207
6 SASI_Rn02_00297127 predicted 256
7 SASI_Rn02_00297128 predicted 281
8 SASI_Rn02_00297129 predicted 386
9 SASI_Rn02_00297130 predicted 251
10 SASI_Rn02_00297131 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052662 predicted 106
2 SASI_Mm02_00349735 predicted 71
3 SASI_Mm01_00052663 predicted 74
4 SASI_Mm01_00052665 predicted 76
5 SASI_Mm01_00052666 predicted 51
6 SASI_Mm01_00052667 predicted 67
7 SASI_Mm01_00052668 predicted 333
8 SASI_Mm01_00052669 predicted 233
9 SASI_Mm01_00052670 predicted 341
10 SASI_Mm01_00052671 predicted 111
11 SASI_Mm01_00052664 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015391
VALIDATED
ANAPC13 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015391.3-737s21c1
Sequence:CCGGGAGAAGCATTCGGAGTGTATTCTCGAGAATACACTCCGAATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-180s21c1
Sequence:CCGGATGTCGCAATACCACTGAATGCTCGAGCATTCAGTGGTATTGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-127s21c1
Sequence:CCGGGATCTTGGATTTGATTGATGACTCGAGTCATCAATCAAATCCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015391.3-454s21c1
Sequence:CCGGAGCAAAGTGCAATGCGAAATTCTCGAGAATTTCGCATTGCACTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-319s21c1
Sequence:CCGGCTGACGCTTGGCTCCTTTCTTCTCGAGAAGAAAGGAGCCAAGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-121s1c1
Sequence:CCGGCGAGAAGACAAGCTGCCTTATCTCGAGATAAGGCAGCTTGTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-341s1c1
Sequence:CCGGCGGTTTGTTTCAGTCTCCAAACTCGAGTTTGGAGACTGAAACAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-223s1c1
Sequence:CCGGGAAATGAAGTGGACAGACTTACTCGAGTAAGTCTGTCCACTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-198s1c1
Sequence:CCGGCACCACAGAATCTGTCAAAGACTCGAGTCTTTGACAGATTCTGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-172s1c1
Sequence:CCGGCCTGAACCTGAACAAGACAATCTCGAGATTGTCTTGTTCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015391
VALIDATED
ANAPC13 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015391.3-737s21c1
Sequence:CCGGGAGAAGCATTCGGAGTGTATTCTCGAGAATACACTCCGAATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-180s21c1
Sequence:CCGGATGTCGCAATACCACTGAATGCTCGAGCATTCAGTGGTATTGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-127s21c1
Sequence:CCGGGATCTTGGATTTGATTGATGACTCGAGTCATCAATCAAATCCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015391.3-454s21c1
Sequence:CCGGAGCAAAGTGCAATGCGAAATTCTCGAGAATTTCGCATTGCACTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-319s21c1
Sequence:CCGGCTGACGCTTGGCTCCTTTCTTCTCGAGAAGAAAGGAGCCAAGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-121s1c1
Sequence:CCGGCGAGAAGACAAGCTGCCTTATCTCGAGATAAGGCAGCTTGTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-341s1c1
Sequence:CCGGCGGTTTGTTTCAGTCTCCAAACTCGAGTTTGGAGACTGAAACAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-223s1c1
Sequence:CCGGGAAATGAAGTGGACAGACTTACTCGAGTAAGTCTGTCCACTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-198s1c1
Sequence:CCGGCACCACAGAATCTGTCAAAGACTCGAGTCTTTGACAGATTCTGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-172s1c1
Sequence:CCGGCCTGAACCTGAACAAGACAATCTCGAGATTGTCTTGTTCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015391
VALIDATED
ANAPC13 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015391.3-737s21c1
Sequence:CCGGGAGAAGCATTCGGAGTGTATTCTCGAGAATACACTCCGAATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-180s21c1
Sequence:CCGGATGTCGCAATACCACTGAATGCTCGAGCATTCAGTGGTATTGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-127s21c1
Sequence:CCGGGATCTTGGATTTGATTGATGACTCGAGTCATCAATCAAATCCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015391.3-454s21c1
Sequence:CCGGAGCAAAGTGCAATGCGAAATTCTCGAGAATTTCGCATTGCACTTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015391.3-319s21c1
Sequence:CCGGCTGACGCTTGGCTCCTTTCTTCTCGAGAAGAAAGGAGCCAAGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-121s1c1
Sequence:CCGGCGAGAAGACAAGCTGCCTTATCTCGAGATAAGGCAGCTTGTCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-341s1c1
Sequence:CCGGCGGTTTGTTTCAGTCTCCAAACTCGAGTTTGGAGACTGAAACAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-223s1c1
Sequence:CCGGGAAATGAAGTGGACAGACTTACTCGAGTAAGTCTGTCCACTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-198s1c1
Sequence:CCGGCACCACAGAATCTGTCAAAGACTCGAGTCTTTGACAGATTCTGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_015391.1-172s1c1
Sequence:CCGGCCTGAACCTGAACAAGACAATCTCGAGATTGTCTTGTTCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181394
VALIDATED
ANAPC13 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 13
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-129s21c1
Sequence:CCGGATATGAGGATGTCGCCATTCCCTCGAGGGAATGGCGACATCCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.2-112s1c1
Sequence:CCGGCGGGAAGATAAGCTACCATATCTCGAGATATGGTAGCTTATCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-82s21c1
Sequence:CCGGAGGATCTTGGACCTGATTGATCTCGAGATCAATCAGGTCCAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-100s21c1
Sequence:CCGGGATGATGCTTGGCGGGAAGATCTCGAGATCTTCCCGCCAAGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181394.2-143s21c1
Sequence:CCGGCCATTCCACTGAGTGAGCTTCCTCGAGGAAGCTCACTCAGTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-112s21c1
Sequence:CCGGCGGGAAGATAAGCTACCATATCTCGAGATATGGTAGCTTATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-211s1c1
Sequence:CCGGGAACAGGAGATGAAGTGGACACTCGAGTGTCCACTTCATCTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-130s1c1
Sequence:CCGGCCATATGAGGATGTCGCCATTCTCGAGAATGGCGACATCCTCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-201s1c1
Sequence:CCGGGTCTGTGAAAGAACAGGAGATCTCGAGATCTCCTGTTCTTTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181394
VALIDATED
ANAPC13 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 13
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-129s21c1
Sequence:CCGGATATGAGGATGTCGCCATTCCCTCGAGGGAATGGCGACATCCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.2-112s1c1
Sequence:CCGGCGGGAAGATAAGCTACCATATCTCGAGATATGGTAGCTTATCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-82s21c1
Sequence:CCGGAGGATCTTGGACCTGATTGATCTCGAGATCAATCAGGTCCAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-100s21c1
Sequence:CCGGGATGATGCTTGGCGGGAAGATCTCGAGATCTTCCCGCCAAGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181394.2-143s21c1
Sequence:CCGGCCATTCCACTGAGTGAGCTTCCTCGAGGAAGCTCACTCAGTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-112s21c1
Sequence:CCGGCGGGAAGATAAGCTACCATATCTCGAGATATGGTAGCTTATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-211s1c1
Sequence:CCGGGAACAGGAGATGAAGTGGACACTCGAGTGTCCACTTCATCTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-130s1c1
Sequence:CCGGCCATATGAGGATGTCGCCATTCTCGAGAATGGCGACATCCTCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-201s1c1
Sequence:CCGGGTCTGTGAAAGAACAGGAGATCTCGAGATCTCCTGTTCTTTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181394
VALIDATED
ANAPC13 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 13
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-129s21c1
Sequence:CCGGATATGAGGATGTCGCCATTCCCTCGAGGGAATGGCGACATCCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.2-112s1c1
Sequence:CCGGCGGGAAGATAAGCTACCATATCTCGAGATATGGTAGCTTATCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-82s21c1
Sequence:CCGGAGGATCTTGGACCTGATTGATCTCGAGATCAATCAGGTCCAAGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-100s21c1
Sequence:CCGGGATGATGCTTGGCGGGAAGATCTCGAGATCTTCCCGCCAAGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181394.2-143s21c1
Sequence:CCGGCCATTCCACTGAGTGAGCTTCCTCGAGGAAGCTCACTCAGTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_181394.2-112s21c1
Sequence:CCGGCGGGAAGATAAGCTACCATATCTCGAGATATGGTAGCTTATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-211s1c1
Sequence:CCGGGAACAGGAGATGAAGTGGACACTCGAGTGTCCACTTCATCTCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-130s1c1
Sequence:CCGGCCATATGAGGATGTCGCCATTCTCGAGAATGGCGACATCCTCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181394.1-201s1c1
Sequence:CCGGGTCTGTGAAAGAACAGGAGATCTCGAGATCTCCTGTTCTTTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks