EMAIL THIS PAGE TO A FRIEND

ANAPC15

anaphase promoting complex subunit 15

Synonyms: APC15 C11orf51
UniProtKB ID: P60006, G3V1Q3, Q9CXK2, Q9Y269
Gene ID:
Mouse(75430) anaphase prompoting complex C subunit 15
Rat(293155) anaphase promoting complex subunit 15
Zebrafish(751740) anaphase promoting complex subunit 15
cow(505356) chromosome 15 open reading frame, human C11orf51
domestic cat(101084987) anaphase promoting complex subunit 15
dog(476817) anaphase promoting complex subunit 15
chicken(100857405) anaphase promoting complex subunit 15
sheep(101120520) anaphase promoting complex subunit 15
naked mole-rat(101699532) anaphase promoting complex subunit 15
domestic guinea pig(100726252) anaphase promoting complex subunit 15
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014042 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090981 MISSION® esiRNA esiRNA targeting mouse 3200002M19Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014042 Rosetta Predictions human pricing
XM_001067917 Rosetta Predictions rat pricing
XM_215003 Rosetta Predictions rat pricing
NM_027532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181462 predicted 256
2 SASI_Hs01_00181463 predicted 751
3 SASI_Hs01_00181464 predicted 486
4 SASI_Hs01_00181466 predicted 252
5 SASI_Hs01_00181467 predicted 831
6 SASI_Hs01_00181468 predicted 481
7 SASI_Hs01_00181469 predicted 257
8 SASI_Hs01_00181470 predicted 243
9 SASI_Hs01_00181471 predicted 278
10 SASI_Hs02_00345031 predicted 629
11 SASI_Hs01_00181465 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322823 predicted 342
2 SASI_Rn02_00322824 predicted 616
3 SASI_Rn02_00322825 predicted 626
4 SASI_Rn02_00322826 predicted 560
5 SASI_Rn02_00322827 predicted 533
6 SASI_Rn02_00322828 predicted 633
7 SASI_Rn02_00322829 predicted 451
8 SASI_Rn02_00322830 predicted 426
9 SASI_Rn02_00322831 predicted 631
10 SASI_Rn02_00322832 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375727 predicted 724
2 SASI_Rn02_00375728 predicted 802
3 SASI_Rn02_00375729 predicted 406
4 SASI_Rn02_00375730 predicted 318
5 SASI_Rn02_00375731 predicted 304
6 SASI_Rn02_00375732 predicted 374
7 SASI_Rn02_00375733 predicted 278
8 SASI_Rn02_00375734 predicted 915
9 SASI_Rn02_00375735 predicted 1012
10 SASI_Rn02_00375736 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332363 predicted 749
2 SASI_Mm02_00332364 predicted 580
3 SASI_Mm02_00332365 predicted 666
4 SASI_Mm02_00332366 predicted 392
5 SASI_Mm02_00332367 predicted 661
6 SASI_Mm01_00061027 predicted 504
7 SASI_Mm02_00332368 predicted 394
8 SASI_Mm02_00332369 predicted 420
9 SASI_Mm02_00332370 predicted 131
10 SASI_Mm02_00332371 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027532
VALIDATED
ANAPC15 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 15
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027532.1-355s1c1
Sequence:CCGGGACAGTGAAGAGGATTCCGAACTCGAGTTCGGAATCCTCTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-608s1c1
Sequence:CCGGGCTTTCCCTTAGGCACTTTCTCTCGAGAGAAAGTGCCTAAGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-261s1c1
Sequence:CCGGCATCGCAGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-412s1c1
Sequence:CCGGGACTATAATGAGTCACCTGATCTCGAGATCAGGTGACTCATTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-390s1c1
Sequence:CCGGGCAAGACATGGATGAGATGAACTCGAGTTCATCTCATCCATGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-268s1c1
Sequence:CCGGGAGAAAGACAACAACCTGGTACTCGAGTACCAGGTTGTTGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027532.1-373s1c1
Sequence:CCGGGAAGATGATGAGGACATGCAACTCGAGTTGCATGTCCTCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-260s21c1
Sequence:CCGGCATCGCAGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-389s21c1
Sequence:CCGGGCAAGACATGGATGAGATGAACTCGAGTTCATCTCATCCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027532.3-607s21c1
Sequence:CCGGGCTTTCCCTTAGGCACTTTCTCTCGAGAGAAAGTGCCTAAGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-411s21c1
Sequence:CCGGGACTATAATGAGTCACCTGATCTCGAGATCAGGTGACTCATTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027532
VALIDATED
ANAPC15 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 15
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027532.1-355s1c1
Sequence:CCGGGACAGTGAAGAGGATTCCGAACTCGAGTTCGGAATCCTCTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-608s1c1
Sequence:CCGGGCTTTCCCTTAGGCACTTTCTCTCGAGAGAAAGTGCCTAAGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-261s1c1
Sequence:CCGGCATCGCAGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-412s1c1
Sequence:CCGGGACTATAATGAGTCACCTGATCTCGAGATCAGGTGACTCATTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-390s1c1
Sequence:CCGGGCAAGACATGGATGAGATGAACTCGAGTTCATCTCATCCATGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-268s1c1
Sequence:CCGGGAGAAAGACAACAACCTGGTACTCGAGTACCAGGTTGTTGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027532.1-373s1c1
Sequence:CCGGGAAGATGATGAGGACATGCAACTCGAGTTGCATGTCCTCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-260s21c1
Sequence:CCGGCATCGCAGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-389s21c1
Sequence:CCGGGCAAGACATGGATGAGATGAACTCGAGTTCATCTCATCCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027532.3-607s21c1
Sequence:CCGGGCTTTCCCTTAGGCACTTTCTCTCGAGAGAAAGTGCCTAAGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-411s21c1
Sequence:CCGGGACTATAATGAGTCACCTGATCTCGAGATCAGGTGACTCATTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027532
VALIDATED
ANAPC15 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 15
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027532.1-355s1c1
Sequence:CCGGGACAGTGAAGAGGATTCCGAACTCGAGTTCGGAATCCTCTTCACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-608s1c1
Sequence:CCGGGCTTTCCCTTAGGCACTTTCTCTCGAGAGAAAGTGCCTAAGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-261s1c1
Sequence:CCGGCATCGCAGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCTGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-412s1c1
Sequence:CCGGGACTATAATGAGTCACCTGATCTCGAGATCAGGTGACTCATTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-390s1c1
Sequence:CCGGGCAAGACATGGATGAGATGAACTCGAGTTCATCTCATCCATGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027532.1-268s1c1
Sequence:CCGGGAGAAAGACAACAACCTGGTACTCGAGTACCAGGTTGTTGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027532.1-373s1c1
Sequence:CCGGGAAGATGATGAGGACATGCAACTCGAGTTGCATGTCCTCATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-260s21c1
Sequence:CCGGCATCGCAGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-389s21c1
Sequence:CCGGGCAAGACATGGATGAGATGAACTCGAGTTCATCTCATCCATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027532.3-607s21c1
Sequence:CCGGGCTTTCCCTTAGGCACTTTCTCTCGAGAGAAAGTGCCTAAGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027532.3-411s21c1
Sequence:CCGGGACTATAATGAGTCACCTGATCTCGAGATCAGGTGACTCATTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014042
VALIDATED
ANAPC15 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 15
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-490s1c1
Sequence:CCGGCATGGACGAGATGAATGACTACTCGAGTAGTCATTCATCTCGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-272s1c1
Sequence:CCGGCTGTGGTTTAATCTGGATCGACTCGAGTCGATCCAGATTAAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-355s1c1
Sequence:CCGGCATCGCGGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-373s1c1
Sequence:CCGGCAACCTGGTTCCTATTGGCAACTCGAGTTGCCAATAGGAACCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-506s1c1
Sequence:CCGGGACTACAATGAGTCACCGGATCTCGAGATCCGGTGACTCATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-362s1c1
Sequence:CCGGGAGAAAGACAACAACCTGGTTCTCGAGAACCAGGTTGTTGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-494s1c1
Sequence:CCGGGACGAGATGAATGACTACAATCTCGAGATTGTAGTCATTCATCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-425s1c1
Sequence:CCGGGAAGAGGATGATGAAGATGATCTCGAGATCATCTTCATCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-358s21c1
Sequence:CCGGGAGAAAGACAACAACCTGGTTCTCGAGAACCAGGTTGTTGTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-421s21c1
Sequence:CCGGGAAGAGGATGATGAAGATGATCTCGAGATCATCTTCATCATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-502s21c1
Sequence:CCGGGACTACAATGAGTCACCGGATCTCGAGATCCGGTGACTCATTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-490s21c1
Sequence:CCGGGACGAGATGAATGACTACAATCTCGAGATTGTAGTCATTCATCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014042
VALIDATED
ANAPC15 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 15
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-490s1c1
Sequence:CCGGCATGGACGAGATGAATGACTACTCGAGTAGTCATTCATCTCGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-272s1c1
Sequence:CCGGCTGTGGTTTAATCTGGATCGACTCGAGTCGATCCAGATTAAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-355s1c1
Sequence:CCGGCATCGCGGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-373s1c1
Sequence:CCGGCAACCTGGTTCCTATTGGCAACTCGAGTTGCCAATAGGAACCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-506s1c1
Sequence:CCGGGACTACAATGAGTCACCGGATCTCGAGATCCGGTGACTCATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-362s1c1
Sequence:CCGGGAGAAAGACAACAACCTGGTTCTCGAGAACCAGGTTGTTGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-494s1c1
Sequence:CCGGGACGAGATGAATGACTACAATCTCGAGATTGTAGTCATTCATCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-425s1c1
Sequence:CCGGGAAGAGGATGATGAAGATGATCTCGAGATCATCTTCATCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-358s21c1
Sequence:CCGGGAGAAAGACAACAACCTGGTTCTCGAGAACCAGGTTGTTGTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-421s21c1
Sequence:CCGGGAAGAGGATGATGAAGATGATCTCGAGATCATCTTCATCATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-502s21c1
Sequence:CCGGGACTACAATGAGTCACCGGATCTCGAGATCCGGTGACTCATTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-490s21c1
Sequence:CCGGGACGAGATGAATGACTACAATCTCGAGATTGTAGTCATTCATCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014042
VALIDATED
ANAPC15 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 15
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-490s1c1
Sequence:CCGGCATGGACGAGATGAATGACTACTCGAGTAGTCATTCATCTCGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-272s1c1
Sequence:CCGGCTGTGGTTTAATCTGGATCGACTCGAGTCGATCCAGATTAAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-355s1c1
Sequence:CCGGCATCGCGGAGAAAGACAACAACTCGAGTTGTTGTCTTTCTCCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014042.1-373s1c1
Sequence:CCGGCAACCTGGTTCCTATTGGCAACTCGAGTTGCCAATAGGAACCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-506s1c1
Sequence:CCGGGACTACAATGAGTCACCGGATCTCGAGATCCGGTGACTCATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-362s1c1
Sequence:CCGGGAGAAAGACAACAACCTGGTTCTCGAGAACCAGGTTGTTGTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-494s1c1
Sequence:CCGGGACGAGATGAATGACTACAATCTCGAGATTGTAGTCATTCATCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014042.1-425s1c1
Sequence:CCGGGAAGAGGATGATGAAGATGATCTCGAGATCATCTTCATCATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-358s21c1
Sequence:CCGGGAGAAAGACAACAACCTGGTTCTCGAGAACCAGGTTGTTGTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-421s21c1
Sequence:CCGGGAAGAGGATGATGAAGATGATCTCGAGATCATCTTCATCATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-502s21c1
Sequence:CCGGGACTACAATGAGTCACCGGATCTCGAGATCCGGTGACTCATTGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014042.2-490s21c1
Sequence:CCGGGACGAGATGAATGACTACAATCTCGAGATTGTAGTCATTCATCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks