EMAIL THIS PAGE TO A FRIEND

ANAPC16

anaphase promoting complex subunit 16

104 Gene Product Result for
Synonyms: APC16 C10orf104 CENP-27 MSAG bA570G20.3
UniProtKB ID: Q96DE5
Gene ID:
Mouse(52717) anaphase promoting complex subunit 16
Rat(100360936) anaphase promoting complex subunit 16
naked mole-rat(101725384) anaphase promoting complex subunit 16
domestic guinea pig(100714226) anaphase promoting complex subunit 16
sheep(101113822) anaphase promoting complex subunit 16
Zebrafish(550576) anaphase promoting complex subunit 16
chicken(423708) anaphase promoting complex subunit 16
dog(608342) anaphase promoting complex subunit 16
cow(540089) anaphase promoting complex subunit 16
domestic cat(101081331) anaphase promoting complex subunit 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA037815 Anti-ANAPC16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173473 Rosetta Predictions human pricing
NM_025514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223343 predicted 323
2 SASI_Hs01_00223344 predicted 528
3 SASI_Hs01_00223345 predicted 461
4 SASI_Hs01_00223346 predicted 663
5 SASI_Hs01_00223347 predicted 666
6 SASI_Hs01_00223348 predicted 265
7 SASI_Hs02_00368228 predicted 493
8 SASI_Hs01_00223349 predicted 562
9 SASI_Hs01_00223351 predicted 392
10 SASI_Hs01_00223352 predicted 677
11 SASI_Hs01_00223350 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328403 predicted 224
2 SASI_Mm01_00165389 predicted 399
3 SASI_Mm01_00165390 predicted 376
4 SASI_Mm01_00165391 predicted 336
5 SASI_Mm01_00165392 predicted 388
6 SASI_Mm01_00165393 predicted 273
7 SASI_Mm01_00165394 predicted 363
8 SASI_Mm01_00165395 predicted 238
9 SASI_Mm01_00165388 predicted 459
10 SASI_Mm01_00165396 predicted 920
11 SASI_Mm01_00165397 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025514
VALIDATED
ANAPC16 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 16
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-366s21c1
Sequence:CCGGCAAGTGGCATCCACGCTTAAACTCGAGTTTAAGCGTGGATGCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-283s21c1
Sequence:CCGGCTCTGTTCACCTACCCGAAAGCTCGAGCTTTCGGGTAGGTGAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-340s21c1
Sequence:CCGGTCCTCTGTGAGTCGGTGTTTACTCGAGTAAACACCGACTCACAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025514.2-1021s21c1
Sequence:CCGGACGGTCACAGCCCAAACATTTCTCGAGAAATGTTTGGGCTGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-453s21c1
Sequence:CCGGGCCGACGAGTGGCGGTTTAAACTCGAGTTTAAACCGCCACTCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-381s1c1
Sequence:CCGGCTTAAACAGGTGAAGCATGATCTCGAGATCATGCTTCACCTGTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-467s1c1
Sequence:CCGGGTTTAAACCCATCGAGCAGCTCTCGAGAGCTGCTCGATGGGTTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-314s1c1
Sequence:CCGGGATGTTAGAAGATGGCTCCGACTCGAGTCGGAGCCATCTTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025514
VALIDATED
ANAPC16 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 16
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-366s21c1
Sequence:CCGGCAAGTGGCATCCACGCTTAAACTCGAGTTTAAGCGTGGATGCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-283s21c1
Sequence:CCGGCTCTGTTCACCTACCCGAAAGCTCGAGCTTTCGGGTAGGTGAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-340s21c1
Sequence:CCGGTCCTCTGTGAGTCGGTGTTTACTCGAGTAAACACCGACTCACAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025514.2-1021s21c1
Sequence:CCGGACGGTCACAGCCCAAACATTTCTCGAGAAATGTTTGGGCTGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-453s21c1
Sequence:CCGGGCCGACGAGTGGCGGTTTAAACTCGAGTTTAAACCGCCACTCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-381s1c1
Sequence:CCGGCTTAAACAGGTGAAGCATGATCTCGAGATCATGCTTCACCTGTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-467s1c1
Sequence:CCGGGTTTAAACCCATCGAGCAGCTCTCGAGAGCTGCTCGATGGGTTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-314s1c1
Sequence:CCGGGATGTTAGAAGATGGCTCCGACTCGAGTCGGAGCCATCTTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025514
VALIDATED
ANAPC16 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 16
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-366s21c1
Sequence:CCGGCAAGTGGCATCCACGCTTAAACTCGAGTTTAAGCGTGGATGCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-283s21c1
Sequence:CCGGCTCTGTTCACCTACCCGAAAGCTCGAGCTTTCGGGTAGGTGAACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-340s21c1
Sequence:CCGGTCCTCTGTGAGTCGGTGTTTACTCGAGTAAACACCGACTCACAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025514.2-1021s21c1
Sequence:CCGGACGGTCACAGCCCAAACATTTCTCGAGAAATGTTTGGGCTGTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025514.2-453s21c1
Sequence:CCGGGCCGACGAGTGGCGGTTTAAACTCGAGTTTAAACCGCCACTCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-381s1c1
Sequence:CCGGCTTAAACAGGTGAAGCATGATCTCGAGATCATGCTTCACCTGTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-467s1c1
Sequence:CCGGGTTTAAACCCATCGAGCAGCTCTCGAGAGCTGCTCGATGGGTTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025514.1-314s1c1
Sequence:CCGGGATGTTAGAAGATGGCTCCGACTCGAGTCGGAGCCATCTTCTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173473
VALIDATED
ANAPC16 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-177s1c1
Sequence:CCGGGATCTGGTTTCAGTGTCTCAGCTCGAGCTGAGACACTGAAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-302s1c1
Sequence:CCGGCAAGTGGCATCCACGCTTAAACTCGAGTTTAAGCGTGGATGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-165s1c1
Sequence:CCGGGTTCTGTCACTGGATCTGGTTCTCGAGAACCAGATCCAGTGACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-242s1c1
Sequence:CCGGGCTGGAGAGATGTTAGAAGATCTCGAGATCTTCTAACATCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-323s1c1
Sequence:CCGGCAGGTGAAACATGATCAGCAACTCGAGTTGCTGATCATGTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173473
VALIDATED
ANAPC16 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-177s1c1
Sequence:CCGGGATCTGGTTTCAGTGTCTCAGCTCGAGCTGAGACACTGAAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-302s1c1
Sequence:CCGGCAAGTGGCATCCACGCTTAAACTCGAGTTTAAGCGTGGATGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-165s1c1
Sequence:CCGGGTTCTGTCACTGGATCTGGTTCTCGAGAACCAGATCCAGTGACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-242s1c1
Sequence:CCGGGCTGGAGAGATGTTAGAAGATCTCGAGATCTTCTAACATCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-323s1c1
Sequence:CCGGCAGGTGAAACATGATCAGCAACTCGAGTTGCTGATCATGTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173473
VALIDATED
ANAPC16 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-177s1c1
Sequence:CCGGGATCTGGTTTCAGTGTCTCAGCTCGAGCTGAGACACTGAAACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-302s1c1
Sequence:CCGGCAAGTGGCATCCACGCTTAAACTCGAGTTTAAGCGTGGATGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-165s1c1
Sequence:CCGGGTTCTGTCACTGGATCTGGTTCTCGAGAACCAGATCCAGTGACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-242s1c1
Sequence:CCGGGCTGGAGAGATGTTAGAAGATCTCGAGATCTTCTAACATCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173473.1-323s1c1
Sequence:CCGGCAGGTGAAACATGATCAGCAACTCGAGTTGCTGATCATGTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks